Электронный научный журнал
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,791

ОСНОВНЫЕ АСПЕКТЫ КОНСТРУИРОВАНИЯ ПРАЙМЕРОВ ДЛЯ ОПРЕДЕЛЕНИЯ ВИДОВОЙ ПРИНАДЛЕЖНОСТИ ДНК КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ

Кригер О.В. 1 Солдатова Л.С. 1 Кравченко А.Ю. 1 Новоселова М.В. 1
1 ФГБОУ ВПО «Кемеровский технологический институт пищевой промышленности»
В работе построена синтетическая последовательность длиной 194 п.н. (ДНК-матрица). Анализ данной последовательности в GenBank с помощью программы BLAST показал, что созданные нуклеотидные последовательности гомологов не имеют. Одними из ключевых компонентов реакции являются «праймеры» - синтетические олигонуклеотиды. Длина амплифицируемого фрагмента определяется расстоянием между праймерами. При амплификации с помощью полимеразной цепной реакции используют два олигонуклеотидных праймера. Рассмотрены теоретические аспекты конструирования праймеров. К синтезированному ДНК-хвосту подобраны 2 праймера размерами 20 п.н. С помощью программы Primer3 подобрана температура плавления (Тm) для соответствующих праймеров: для правого праймера Тm = 59,80°С, для левого праймера Тm = 60,25°С. Оптимальная температура соответствующего режима в программе амплификации (температура отжига) ta составляет: для левого праймера ta = 56,00°С, для правого праймера ta = 55,80°С.
олигонуклеотид
праймер
прионный белок
патоген
амплификация
1. Григорьев В. Б. Прионные болезни человека и животных // Вопросы вирусологии. – 2004. – Т. 6. – С. 4-12.
2. Завалишин И. А. Прионы и прионные болезни / И. А Завалишин, И. Е. Шитикова, Т. Д. Жученко // Клиническая микробиология. – 2000. – Т. 2. – №2. – С. 12-19.
3. Зуев В. А. Прионы – новый класс возбудителей инфекционных заболеваний // Анти-биотики и химиотерапия. – 1999. – № 10. – С. 33-38.
4. Инге-Вечтомов С. Г. Цитогены и прионы: цитоплазматическая наследственность без ДНК? // Соросовский образовательный журнал. – 1996. – №5. – С. 11-18.
5. Покровский В. И. Прионы и прионные болезни / В. И. Покровский, О. И. Киселев, Б. Л. Черкасский. – М.: РАМН, 2004. – 384 с.
6. Смелкова Н. В. Конструирование ДНК-матриц заданной структуры для синтеза РНК посредством полимеразных цепных реакций / Н. В. Смелкова, А. А. Елов, З. А. Шабарова // Биоорганическая химия. – 1992. – Т. 18. – №1. – С. 78-84.
7. Saiki R. K. Primer-directed enzymatic amplification of DNA with a thermostable DNA pol-ymerase // Science. – 1988. – V. 239. – №4839. – Р. 487-491.
8. Swarz K. // Nucl. Acids Res. – 1990. – V. 18. – №4. – Р. 1097.
Введение

Прионные болезни - это особый класс смертельных нейродегенеративных заболеваний человека и животных, возбудителем которых является прион - безнуклеиновый низкомолекулярный белок, устойчивый к инактивирующим воздействиям [1].

В последние годы проблема прионных болезней приобрела важное научно-практическое значение, поскольку открытие прионов в 80-е годы XX столетия явилось прорывом в изучении инфекционной патологии, микробиологии, молекулярной биологии, патоморфологии и философии живого в целом [2].

Рост практического интереса к прионным болезням в настоящее время связан со вспышкой спонгиформной энцефалопатии коров в Великобритании («коровье бешенство») [3]. Распространенность прионных заболеваний человека весьма различна в зависимости от конкретного вида патологии и исследуемого региона. Наиболее изучена распространенность болезни Кройцфельдта - Якоба (БКЯ), встречающейся почти во всех регионах с практически одинаковой частотой: 0,3-1 случай на 1 млн  населения в год [4].

Основными методами диагностики данной патологии остаются следующие: иммунодиффузия в геле, изоэлектрическое фокусирование, радиоизотопный метод и иммуноферментный анализ  [5]. Однако существующие методы определения видовой принадлежности животных белков оказываются малоэффективными, поскольку биологический материал зачастую проходит термическую обработку, ведущую к денатурации белков, следствием  чего является потеря ими видовой специфичности. В отличие от белков, ДНК более устойчива к термической обработке и не утрачивает своей информативной функции.

Поэтому применение молекулярно-генетических методов является перспективным для определения видовой принадлежности ДНК. Учитывая отсутствие доступных и информативных методик, необходимых для мониторинга мяса животных, разработка ПЦР-тест-системы для определения видовой принадлежности мясных ингредиентов является весьма актуальной.

Цель исследования

Настоящее исследование направлено на изучение основных аспектов конструирования праймеров для определения видовой принадлежности ДНК крупного рогатого скота методом полимеразной цепной реакции.

Материалы и методы исследования

Конструирование ДНК-матрицы осуществляли с использованием метода полимеразной цепной реакции (ПЦР) [6], который позволяет не только получать индивидуальные копии выбранных фрагментов любых ДНК, но и соединять эти фрагменты в любом месте. Последнее в сочетании с химическим синтезом фрагментов ДНК дает возможность получать ДНК-матрицы заданной структуры. Их длина ограничена только возможностями ПЦР, которая позволяет получать ДНК длиной до 2900 п.н. [7] и более [8].

Анализ олигонуклеотидных последовательностей осуществляли в GenBank с помощью программы BLAST.

Выбор параметров праймеров проводили с помощью программы Primer 3.

Результаты исследования и их обсуждение

Праймер представляет собой короткий фрагмент нуклеиновой кислоты, который служит стартовой точкой при репликации ДНК в методе полимеразной цепной реакции (ПЦР).

Непосредственно проектированию праймеров предшествует предварительный этап построения подробной модели гена-мишени или иной последовательности нуклеиновой кислоты, которую планируется амплифицировать.

Для проведения иммуно-ПЦР анализа необходима ДНК-матрица (ДНК-хвост).

Чтобы снизить риск ложных срабатываний за счет экзогенных загрязнений ДНК, был разработан ДНК-хвост, неизвестный на данный момент.

Была построена синтетическая последовательность длиной 194 п.н. (учитывая, что наиболее оптимальной длиной считают фрагменты  в диапазоне 150-300 пар оснований), полученная случайным образом:

ДНК-хвост:

 

AGGAGGTGGCCACGACTGCGAAGGAGGTGGCGTAGGATAGAGTCAGTCCTTGGCC

TCCTTGGCCCAGTTAAGAAGTTGCAGCCACACACGCTGTTGTTGGGTTCGGGGCGG

AGTTGCAGCCATCTACACAAACGATACCCTCGTGCAGCTGGAGAAGCAGCACGGCC

TATTACCTGGAGGAGGATCGAAACTGA

 

Созданная последовательность была проанализирована в GenBank с помощью программы BLAST. Используя данную программу, сравнили имеющуюся  последовательность с последовательностями из базы данных и определили наличие гомологов. Проведенный анализ показал, что созданные нуклеотидные последовательности гомологов не имеют.

Одними из ключевых компонентов реакции  являются  «праймеры» - синтетические олигонуклеотиды. Праймеры комплементарны противоположным цепям ДНК в участках, ограничивающих выбранную область ДНК, и ориентированы З'-концами навстречу друг другу и в сторону той последовательности, которую необходимо амплифицировать. Длина амплифицируемого фрагмента определяется расстоянием между праймерами.

При амплификации с помощью ПЦР используют два олигонуклеотидных праймера (затравки). Праймеры подбираются таким образом,  чтобы синтез с помощью полимеразы протекал только между ними,  удваивая количество копий этого участка ДНК. В результате происходит экспоненциальное увеличение количества специфического фрагмента.

Конструирование праймеров  -  возможно, наиболее критический параметр для успешного проведения ПЦР. При прочих условиях, плохо сконструированный праймер может привести к ПЦР-реакции, которая не даст положительного результата. Последовательность праймера определяет целый ряд показателей, таких как позиция и длина продукта, его температура плавления и, безусловно, выход продукта. Плохо сконструированный праймер может привести к малому количеству продукта или его отсутствию вследствие неспецифической амплификации и/или образования димера праймера, который может стать конкурентным настолько, что будет подавлять образование продукта. Эти указания по применению проводятся для того, чтобы обозначить правила, которые следует принимать во внимание при конструировании праймеров для ПЦР.

При конструировании праймеров для ПЦР следует принимать во внимание несколько параметров. Среди них есть наиболее критические:

  • длина праймера;
  • температура плавления (Tm) и температура отжига;
  • специфичность;
  • комплементарная последовательность праймера;
  • G/C содержание и полипиримидиновые (Т, С) или полипуриновые (A, G) протяженные участки;
  • вторичная структура сайта-мишени;
  • вторичная структура праймера;
  • гомо- и гетеродимеризация праймеров.

Длина праймера. Поскольку специфичность, температура и время отжига частично зависят от длины праймера, этот параметр является критическим для успешного осуществления ПЦР. В идеале праймер должен иметь размер от 15 до 30 нуклеотидов. Длина праймера также пропорциональна эффективности отжига. Если меньше количество матриц на каждой стадии обеспечено праймерами, это может привести к значительному снижению выхода амплифицированного продукта. Праймеры, однако, не должны быть слишком короткими, если это только специально не требуется для особого применения.

Температура плавления. Оба олигонуклеотидных праймера следует конструировать таким образом, что бы они имели примерно одинаковую температуру плавления. Если праймеры не совпадают в отношении Tm, амплификация будет менее эффективной, или может вовсе не сработать, так как праймер с более высокой Tm будет неправильно работать при более низкой температуре.

 Тm праймера - температура, при которой концентрация гетеродимеров праймера с матрицей равна половине от максимально возможной концентрации таких гетеродимеров в реакционной смеси.

Разница в Тm между двумя праймерами одной и той же пары не должна превышать 4-6 градусов. Если же Тm двух праймеров различается существенно, то праймер с наименьшей Тm может быть удлинен с 3'-конца (с сохранением размера конечного продукта) или 5'-конца (с эквивалентным увеличение размера конечного продукта).

Температура «отжига» праймера. Ta праймера - это температура, при которой происходит гибридизация праймера с матрицей. Ta на 4-5оС (а по мнению некоторых авторов, на 1-2 оС) ниже Тm праймера.

Специфичность. В идеале праймер должен обладать 100 %-ной комплементарностью по отношению к сайту-мишени и не распознавать другие, даже очень близкие по нуклеотидному составу, последовательности. Однако практика показывает, что эффективными могут быть и праймеры, не обладающие 100 %-ной комплементарностью и имеющие достаточно высокую степень гомологии (но не более 70 %) по отношению к другим нуклеотидным последовательностям.

Специфичность праймера, по крайней мере, частично, зависит от длины праймера. Очевидно, что существует гораздо больше уникальных олигонуклеотидов из 24 оснований, чем из 15 оснований. Таким образом, праймеры следует выбирать так, чтобы они имели уникальную последовательность, находящуюся внутри матричной ДНК, которую предполагается амплифицировать. Праймер, сконструированный так, что он содержит высокоповторяющуюся последовательность, в результате даст размазанное пятно при амплификации геномной ДНК. Однако тот же самый праймер может и единичную полосу, если амплифицируется единичный клон из геномной библиотеки. Вследствие того, что  Taq-ДНК полимераза активна в широком диапазоне температур, удлинение праймера будет происходить при более низких температурах отжига. Если температура слишком низка, может происходить неспецифическое функционирование праймера, который может расти под действием полимеразы, если имеется короткая гомология у 3'-конца. В целом, температура плавления в 55-72 °С дает наилучшие результаты.

Комплементарная последовательность праймера. Праймер следует конструировать так, чтобы в нем абсолютно отсутствовала внутренняя гомология, превышающая 3 нуклеотидные пары. Если праймер имеет такой участок гомологии, могут создаваться частично двухцепочечные структуры, типа «обратного схлопывания» или «шпилек», которые будут мешать отжигу с матрицей. Другая относительная опасность - это гомология между праймерами. Частичная гомология встречается у 3'-конца любого праймера, будет происходить образование димера, который чаще всего будет противодействовать образованию желаемого продукта.

G/C cодержание и полипиримидиновые (Т,С) или полипуриновые (А, G) протяженные участки. Состав оснований в праймере должен быть между 45 % и 55 % содержанием GC. Последовательность праймера должна быть выбрана таким образом, чтобы не было поли-G или поли-С протяженных участков, которые могут способствовать неспецифическому отжигу. Поли-А и поли-Т протяженных участков тоже следует избегать, так как они будут «дышать» и раскрывать протяженные участки комплекса праймер-матрица. Это может снизить эффективность амплификации. Не следует допускать также образования полипиримидиновых (Т, С) или полипуриновых (А, G) протяженных участков. Идеально, праймер должен содержать почти случайную смесь нуклеотидов, иметь содержание  GC-50-55 % и длину~20 оснований. Это даст Tm в пределах 56-62 °С.

Вторичная структура праймера. Праймер не должен укладываться во вторичную структуру, температура плавления которой была бы эквивалентна или выше Тm праймера. При наличии такой структуры эффективность связывания праймера с соответствующей нуклеотидной последовательностью сайта-мишени будет низкой.

Вторичная структура сайта-мишени. Сайт-мишень (область матрицы, комплементарная праймеру) не должен укладываться во вторичную структуру, температура плавления которой была бы эквивалентна или выше Тm праймера. При наличии такой структуры эффективность связывания праймера с сайтом-мишенью будет низкой.

Гомо- и гетеродимеризация праймеров. Возможность гомо- и гетеродимеризации праймеров при температуре, равной или выше температуры  их «отжига», должна быть полностью исключена, особенно с 3'-конца, так как это может привести к снижению выхода конечного продукта ПЦР (вплоть до его полного отсутствия).

Учитывая представленные параметры, к  синтезированному ДНК-хвосту подобрали следующие  2 праймера размерами 20 п.н.:

1) >>>>>> левый праймер - с 41 п.н.- AGTCAGTCCTTGGCCTCCTT

2) <<<<<< правый праймер - с 193 п.н.- CAGTTTCGATCCTCCTCCAG

    1

AGGAGGTGGCCACGACTGCGAAGGAGGTGGCGTAGGATAGAGTCAGTCCTTGGCCTCCTT

                                              >>>>>>>>>>>>>>>>>>>>

   61

GGCCCAGTTAAGAAGTTGCAGCCACACACGCTGTTGTTGGGTTCGGGGCGGAGTTGCAGC

                                                                 

  121

CATCTACACAAACGATACCCTCGTGCAGCTGGAGAAGCAGCACGGCCTATTACCTGGAGG

                                                           <<<<<<<

  181 AGGATCGAAACTGA

      <<<<<<<<<<<<<

С помощью программы Primer 3 была подобрана температура плавления (Тm) и другие параметры для соответствующих праймеров, представленные в табл. 1.

Таблица 1 Параметры праймеров

OLIGO

Старт, п.н.

СG

Длина, п.н.

Тm,°С

seq

Левый праймер

41

55

20

60,25

AGTCAGTCCTTGGCCTCCTT

Правый праймер

193

55

20

59,80

CAGTTTCGATCCTCCTCCAG

Соответственно, для правого праймера она равна  tm =59,80 °С, для левого - tm = 60,25 °С.

Температуру отжига принимают на  4-5 градусов ниже, чем температура плавления.

Следовательно, оптимальная температура соответствующего режима в программе амплификации (температура отжига) ta будет составлять:

Для левого праймера: ta =56,00 °С.

Для правого праймера: ta=55,80 °С.

Представляется перспективным в последующей работе использовать выбранные праймеры для разработки тест-системы для идентификации ДНК крупного рогатого скота и выявления возбудителя прионных заболеваний в образцах мясного сырья.

Заключение

Таким образом, при выполнении работы построена синтетическая последовательность длиной 194 п.н., полученная случайным образом (ДНК-хвост). Анализ в GenBank с помощью программы BLAST показал, что созданная последовательность и последовательности базы данных гомологов не имеют.

К  синтезированному ДНК-хвосту подобраны 2 праймера размерами 20 п.н.

С помощью программы Primer 3 подобраны параметры для соответствующих праймеров.

Результаты проведенных исследований целесообразно использовать при разработке тест-систем для идентификации ДНК крупного рогатого скота.

* Работа выполнена в рамках федеральной целевой программы «Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2013 годы» (государственный контракт №16.512.11.2077).

Рецензенты:

  • Майоров Александр Альбертович, доктор технических наук, профессор, директор ГНУ СибНИИС СО Россельхозакадемии, 656016, г. Барнаул.
  • Гаврилов Гавриил Борисович, доктор технических наук, директор Ярославского государственного института качества сырья и пищевых продуктов, г. Ярославль.

Библиографическая ссылка

Кригер О.В., Солдатова Л.С., Кравченко А.Ю., Новоселова М.В. ОСНОВНЫЕ АСПЕКТЫ КОНСТРУИРОВАНИЯ ПРАЙМЕРОВ ДЛЯ ОПРЕДЕЛЕНИЯ ВИДОВОЙ ПРИНАДЛЕЖНОСТИ ДНК КРУПНОГО РОГАТОГО СКОТА МЕТОДОМ ПОЛИМЕРАЗНОЙ ЦЕПНОЙ РЕАКЦИИ // Современные проблемы науки и образования. – 2012. – № 2.;
URL: http://www.science-education.ru/ru/article/view?id=5964 (дата обращения: 08.12.2019).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074