Электронный научный журнал
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

ИССЛЕДОВАНИЯ ЧАСТОТЫ НАСЛЕДСТВЕННЫХ МУТАЦИЙ У БОЛЬНЫХ С ЗАБОЛЕВАНИЯМИ ЖЕНСКОЙ РЕПРОДУКТИВНОЙ СФЕРЫ В КБР

Жантуева Л.А. 1 Пардилова С.А. 1 Канцалиев А.Л. 2 Пирмагомедов А.Ш. 2 Боготова З.И. 1 Биттуева М.М. 1 Гидова Э.М. 1 Паритов А.Ю. 1 Даурова Л.В. 1 Ситников М.Н. 1 Хандохов Т.Х. 1
1 Кабардино-Балкарский государственный университет им. Х.М. Бербекова
2 Онкологический диспансер
В ходе исследования проведена работа по формированию банка ДНК больных раком молочной железы (РМЖ) и здоровых жительниц Кабардино-Балкарской Республики для определения групп риска с повышенной предрасположенностью развития наследственной формы рака молочной железы. В контрольной и опытной группе собраны образцы крови и ДНК более 400 человек. Проведён анализ частоты встречаемости мутаций 1100delC, Ile157Thr гена CHEK2 и 6174delT гена BRCA2 у больных с заболеваниями женской репродуктивной сферы и в контрольной группе. Выявлены 6 носителей делеции тимина в позиции 6174 гена BRCA2 среди больных раком молочной железы (3 %). Мутации 1100delC, Ile157Thr гена CHEK2 в исследуемых выборках не выявлены. Полученные данные расширяют представления о молекулярно-генетических механизмах возникновения рака органов женской репродуктивной системы и дают возможность определить группы наибольшего риска больных раком молочной железы в условиях наследственной предрасположенности.
рак органов женской репродуктивной сферы
рак молочной железы
рак яичников
ген BRCA1
ген BRCA2
медико-генетическое консультирование
Кабардино-Балкария
1. Анохина Е. Н. Этногеографические особенности распределения мутаций генов BRCA1/2 при злокачественных новообразованиях женских репродуктивных органов // Вестник Адыгейского государственного университета. – 2012. – № 2. – С. 5.
2. Имянитов Е. Н. Наследственный рак молочной железы // Журнал «Практическая онкология». – 2010. – № 4, т. 1. – С. 259.
3. Куликов А. Ю., Комаров И. А. Фармокоэкономический анализ лекарственного средства кадсила (трастузумабэмтанзин) в лечении рака молочной железы у больных с HER2+ формой заболевания // Журнал «Фармакоэкономика: теория и практика». – 2015. – № 2, т. 3. – С. 24.
4. Любченко Л. Н. Генетическое тестирование при наследственном раке молочной железы // Журнал «Практическая онкология». – 2014. – № 3, т. 15. – С. 107.
5. Смоланка И. И., Скляр С. Ю., Лобода А. Д. Профилактическая мастэктомия: взгляд на проблему // Журнал «Эстетическая медицина». – 2013. – № 3 (33). – С. 6.
6. Умарова С. Г., Зикиряходжаев А. Д., Каримова Ф. Н., Мирзоева Д. С. Эпидемиология злокачественных новообразований органов репродуктивной системы в Республике Таджикистана // Журнал «Опухоли женской репродуктивной сферы». – 2012. – № 1. – С. 24.
7. Ходорович О. С. Наследственная форма рака молочной железы. Методы профилактики // Вестник Российского научного центра рентгенорадиологии Минздрава России. – 2012. – Вып. 12. – Т. 2. – С. 4.
8. Economopoulou P., Dimitriadis G., Psyrri A. Beyond BRCA: New hereditary breast cancer susceptibility genes // Cancer Treatment. – 2015. – Vol. 41. – p. 1-8.
9. Petrucelli N., Daly M. B., Feldman G. L. Hereditary breast and ovarian cancer due to mutations inBRCA1 and BRCA2 // Genetics in Medicine. – 2010. – Vol. 12. – p. 245-259.

У женщин наиболее частыми раковыми заболеваниями как в мире, так и в России и Кабардино-Балкарской республике являются опухоли органов женской репродуктивной сферы (ООЖРС), на долю которых приходится 35 %. Удельный вес рака женских половых органов составляет 17 %, при этом летальность с момента установления диагноза составляет до 21,8 %. В связи со сложившейся ситуацией у больных с запущенными стадиями опухолевой трансформации наблюдается высокий показатель заболевания, что составляет: при раке яичников (РЯ) – 62 % и раке молочной железы (РМЖ) – 38 % [6]. Самой частой разновидностью наследственных опухолевых синдромов является наследственный рак молочной железы (НРМЖ), общая встречаемость которого выявляется примерно в 5–10 %. «Классические» разновидности РМЖ ассоциированы с повышенным риском развития рака яичников (РЯ), поэтому в литературе используется термин «синдром РМЖ/РЯ» (breast-ovarian cancer syndrome). Генетические дефекты являются причиной 10–15 % случаев рака яичников (РЯ) [2]. Наиболее опасным онкологическим синдромом среди женского населения представляет рак молочной железы. Наиболее высокая смертность женщин в группе риска больных РМЖ в разные возрастные периоды составляет: в возрасте 40–49 лет – 27,3 %, 50–59 лет – 25,4 %, 30–39 лет – 20 % и 60–69 лет – 17 %. Для женщин в возрасте 70 лет и старше первое место занимают опухоли желудка (15,8 %), а рак молочной железы (12,3 %) на втором месте. В России в 2013 году число новых случаев рака молочной железы составило 57307, а общее количество больных – 562053 человек [3].

К числу РМЖ-ассоциированных генов относят BRCA1, BRCA2, TP53, PTEN, CHEK2, ATM и PALB2 [8]. Наиболее широко изучены гены BRCA1 и BRCA2. Дефекты генов BRCA характеризуются высокой пенентрантностью, что составляет 70 % всех генетических мутаций РМЖ/РЯ [4]. Средний риск развития РМЖ при повреждении BRCA1 гена до 70 лет составляет 65 % и 39 % для рака яичников, BRCA2 – 45 % и 11 % [5]. Наблюдаются значительные вариации в распределении мутационных повреждений в этих генах в различных популяциях и географических зонах проживания [7]. В частности, делеция BRCA2 6174delT является мутацией-основателя у евреев-ашкенази и встречается с частотой 8 % у больных после 42 лет [9]. В США и Канаде мутация идентифицирована с частотой 1,2–16,4 %, у славянок частота не превышает 1 % [3]. В связи с актуальностью изучения данной проблемы нами было проведено исследование данной патологии в Кабардино-Балкарской республике. В связи с этим целью нашей работы явился поиск мутаций 1100delC, Ile157Thr гена CHEK2 и 6174delT гена BRCA2, у больных с заболеваниями женской репродуктивной сферы в Кабардино-Балкарской Республике.

Материал и методы исследования

В ходе совместной научно-исследовательской работы создан банк биологического материала: цельная кровь и ДНК пациентов, страдающих наследственным и спорадическим раком молочной железы, проживающих на территории Кабардино-Балкарской республики.

Для проведения популяционного исследования образцы венозной крови жителей КБР, больных РМЖ были собраны на базе ГБУЗ «Онкологический диспансер» МЗ КБР и ФГОУ ВПО «Кабардино-Балкарский государственный университет им. Х.М. Бербекова», начиная с 2009 по 2015 г. В данной работе мы проанализировали результаты обследования и лечения 200 больных раком молочной железы в возрасте от 25–78 лет, которые представлены по материалам ГБУЗ «ОД» КБР. Популяционно-генетические данные о каждом участнике эксперимента (контрольная и опытная группы) собраны путём опроса и занесены в специально разработанную формализованную анкету – карту (ФК). ФК заполнялась индивидуально на каждого участника эксперимента. Исследование проводилось на основании письменного согласия всех участников. При обработке информации учитывались ряд сведений. Были собраны данные о возрасте пациентов, их этнической принадлежности, возраст манифестации заболевания, выявленные случаи в семье онкопатологий, стадия заболевания, локализация и морфологические характеристики опухоли, возраст менархе, наличие детей, связь работы с вредными факторами среды, стаж курения или его отсутствие.

Выделение ДНК проводилось из лимфоцитов периферической венозной крови вручную с помощью набора реагентов "QIAamp DNA Blood Mini Kit" (фирмы "Qiagen", Германия). При проведении аллель-специфичной ПЦР-реакции был использован набор реагентов, изготовленных ООО «Лаборатория Изоген» (Россия), фирма «Литех» (Россия).

В исследовании применялись соответствующие праймеры, представленные в табл.1.

Таблица 1

Праймеры для определения мутаций гена CHEK2 (1100delC, Ile157Thr) и BRCA2 (6174 delT)

CHEK2

Ile157Thr

Общий

Дикий

5'-TTCCCACTATAAATCTCTGCTATTCAA -3'

5'-GAGCAATTTCAGAATTGTTATTCAAAGG -3'

CHEK2

1100delC

Общий

Дикий

Мутантный

5’-CTGATCTAGCCTACGTGTCT-3’

5’-TTGGAGTGCCCAAAATCAGT-3’

5’- CTTGGAGTGCCCAAAATCAT-3’

BRCA2

6174delT

Общий

Дикий

Мутантный

5’- CATAACCAAAATATGTCTGGATTGGAG - 3’

5’- CTGATACCTGGACAGATTTTCCAC - 3’

5’- CCTGGACAGATTTTCCCTTGC - 3’

Амплифицированный специфический фрагмент ДНК выявляют методом электрофореза в 2 % агарозном геле толщиной 6–7 мм в присутствии бромистого этидия. Электрофорез проводился в горизонтальном аппарате для электрофореза Mini-Sub Cell GT при 100–200 В в течение 20–30 мин. Данные анализировали с помощью аналитической системы БиоДок-Ит М-26X при облучении геля УФ-излучением с длиной волны 290–330 нм.

Результаты и обсуждения

Индивидуальные данные об условиях и образе жизни участников эксперимента

Известно, что частота и спектр наследственных мутаций варьирует в разных популяциях. В связи с этим в ходе исследования учитывались данные об этнической принадлежности пациенток и выяснения национальной принадлежности родителей до третьего поколения. По этническому составу в контрольную и опытную группу входят три доминирующие нации: кабардинцы, балкарцы, русские (рис.1, 2).

Рис. 1. Этнический состав обследованных больных раком молочной железы

Рис. 2. Этнический состав контрольной группы

По возрастному составу контрольная и опытная группа несколько отличались. В контрольной группе возраст женщин колеблется от 20 до 69 лет (средний возраст 31,3 лет) (рис. 3).

Рис. 3. Возрастной состав контрольной группы

В группе больных РМЖ – от 20 до 79 лет (средний возраст 51 год) (рис. 4).

Рис. 4. Возрастной состав обследованных больных

Проведя анализ данных по возрастному составу больных РМЖ, было отмечено, что пик манифестации заболевания приходится на возрастную группу от 50 до 59 лет, что составляет 40 % от всей выборки больных РМЖ.

Случаи онкопатологий в семьях у исследуемых лиц

Для дальнейшего анализа большое внимание было уделено выявлению в семьях исследуемой выборки случаев заболевания другими онкопатологиями и РМЖ в частности.

Среди группы больных отмечено наличие случаев различных форм рака в анамнезе у представителей разной степени родства (табл. 2).

Таблица 2

Процентное соотношение формы рака молочной железы и другой онкопатологии в исследуемой выборке больных

Степень родства

Случаи различных онкопатологий (%)

Случаи семейного РМЖ

(%)

Ι степень

15

6

II степень

9

3

III степень

2,5

2

Всего

16,5

11

Распределение больных раком молочной железы по характеру менструально-овариальной функции.

Среди исследуемой группы пациенток с РМЖ средний возраст менархе составил 12,2 лет. По состоянию репродуктивной функции больные распределились следующим образом: сохранённая функция у 95 больных раком молочной железы (47,5 %) (табл. 3).

Таблица 3

Распределение исследуемых выборок по характеру менструально-овариальной функции

Характер менструально-овариальной функции

Число больных РМЖ

Число исследуемых (контрольная группа)

абс.

%

абс.

%

Менструации сохранены

95

47,5

139

69,5

Менопауза

105

52,5

61

30,5

Всего

200

100

200

100

У 89 % пациенток имеются дети, из них 88 % кормили ребёнка грудью. При проведении анкетирования нами было выявлено, что у 85 % работа не связана с вредным воздействием производства, и только у 15 % работа ранее была связана с химическими реактивами и изотопами. Неоднократное раннее прерывание беременности выявлено у 77,5 % женщин в опытной группе.

Среди контрольной группы средний возраст менархе составил 12,7 лет. У 68 % имеются дети, из них 98 % кормили ребёнка грудью. У 61 (30,5 %) женщин наступил менопаузальный статус.

Изучение мутаций 1100delC и I1e57Thr гена CHEK2, 6174delТ гена BRCA2 у больных с заболеваниями женской репродуктивной сферы

Наблюдаются значительные вариации в распределении мутационных повреждений в генах BRCA1, BRCA1 и CHEK2 в различных популяциях и географических зонах проживания в некоторых странах и этнических группах. Спектр повреждений BRCA и CHEK2 ограничен специфическими мутациями с так называемым эффектом основателя («founder»), что значительно упрощает диагностику наследственных форм РМЖ. В отличие от BRCA1 и BRCA2, инактивация гена CHEK2 увеличивает риск возникновения РМЖ в несколько меньшей степени. Делеция тимина в позиции 6174 гена BRCA2 идентифицирована у афроамериканок и евреев-ашкенази с раком молочной железы и раком яичников, проживающих в США, Израиле, Канаде, с частотой 1,2–16,4 %. У славянок частота не превышает 1 % [1].

Мутация 6174delT в гене BRCA2 является мутацией-основателя у евреев-ашкенази и встречается с частотой 8 % у больных после 42 лет. В возрасте 70 лет для евреев-ашкенази частота мутации 6174delT составляет 43 % и рака яичников – 20 % [9].

Изучена частота мутаций 1100delC, Ile157Thr гена CHEK2 и 6174delT гена BRCA2. Выявлены 6 носителей делеции тимина в позиции 6174 гена BRCA2 среди больных раком молочной железы (3 %) и 1 носитель аллеля 1100delC гена CHEK2 (0,5 %). У 1 пациентки, являющейся носительницей мутации, отмечены случаи заболевания онкопатологией в семье. Средний возраст манифестации заболевания у носителей данной мутации составил 56,1 лет, тогда как средний возраст пациентов без мутации 60 лет. Группа носительниц мутации неоднородна по этническому составу: русские, балкарцы, кабардинцы. По стадиям заболевания группа больных раком молочной железы, являющихся носителями делеции тимина в позиции 6174 гена BRCA2, распределились следующим образом: I стадия заболевания установлена у 1 (16,6 %) пациенток, IIA стадия – у 1 (16,6 %), IIIA стадия установлена у 4 (66,8 %) пациенток.

Мутация Ile157Thr гена CHEK2 в исследуемых выборках не выявлена.

По данным литературы, опухоли, вызванные мутациями генов BRCA1 и BRCA2, имеют более высокую степень злокачественности относительно спорадических случаев рака молочной железы. Для нашей выборки больных с мутацией 6174delT гена BRCA2 и 1100delC гена CHEK2 характерна средняя степень злокачественности, возможно, что такое отличие связано с небольшим количеством носителей мутации, выявленных в работе.

В контрольной группе изучаемые в работе мутации выявлены не были.

Результаты, полученные в ходе исследования, являются промежуточными. Дальнейшее пополнение выборки позволит сделать окончательные выводы по частотам встречаемости наследственных мутаций, ассоциированных с развитием онкопатологий женской репродуктивной сферы, в популяционных выборках в КБР.

Заключение

В настоящее время предлагается проведение систематических ассоциативных исследований генов, связанных с риском развития рака органов женской репродуктивной сферы у жительниц Кабардино-Балкарской республики. Полученные результаты позволяют создать реальную основу для индивидуального и группового прогнозирования рисков развития рака молочной железы и рака яичников в условиях наследственной предрасположенности, а также выявить особенности варьирования генов, вовлечённых в канцерогенез, характерные для популяции Кабардино-Балкарии.

Применение данного метода впервые в Кабардино-Балкарской республике может способствовать выявлению заболевания на ранних этапах, подбору оптимальной индивидуальной тактики лечения и профилактики, а также снижению смертности от опухолей молочной железы.


Библиографическая ссылка

Жантуева Л.А., Пардилова С.А., Канцалиев А.Л., Пирмагомедов А.Ш., Боготова З.И., Биттуева М.М., Гидова Э.М., Паритов А.Ю., Даурова Л.В., Ситников М.Н., Хандохов Т.Х. ИССЛЕДОВАНИЯ ЧАСТОТЫ НАСЛЕДСТВЕННЫХ МУТАЦИЙ У БОЛЬНЫХ С ЗАБОЛЕВАНИЯМИ ЖЕНСКОЙ РЕПРОДУКТИВНОЙ СФЕРЫ В КБР // Современные проблемы науки и образования. – 2016. – № 3.;
URL: http://www.science-education.ru/ru/article/view?id=24788 (дата обращения: 25.07.2021).


Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074