Электронный научный журнал
Современные проблемы науки и образования
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

ПОТЕНЦИАЛЬНАЯ ВОЗМОЖНОСТЬ АНТИСМЫСЛОВОЙ ТЕРАПИИ COVID-19

Горячев А.Н. 1 Калантаров С.А. 1 Ткачев В.В. 2 Северова А.Г. 2 Горячева А.С. 2
1 ГБУЗ Ставропольского края «Городская клиническая больница»
2 ООО «Медицинский центр Профмед»
Приведены данные о потенциальной эффективности и перспективности лечения новой коронавирусной инфекции COVID-19, вызываемой вирусом SARS-CoV-2, с помощью антисмысловых олигонуклеотидов, действующих против РНК вируса. Показана способность антисмысловых олигонуклеотидов подавлять репликацию вируса при заболеваниях, вызываемых коронавирусами, на примере атипичной пневмонии и MERS. Обнаружена идентичность начального регуляторного участка РНК различных коронавирусов в пределах 50–100 нуклеотидов от 5`-конца, позволяющая использовать антисмысловое подавление этого фрагмента РНК. Определен новый фрагмент РНК вируса, присутствующий во всех образцах коронавируса SARS-CoV-2, подавление которого с помощью антисмыслового олигонуклеотида может быть эффективным в лечении COVID-19. Проведено исследование синтезированного антисмыслового олигонуклеотида 5`–AGCCGAGTGACAGCC ACACAG, комплементарного выбранной последовательности РНК вируса. Показаны низкая токсичность препаратов данной группы при исследовании на культуре клеток и способность к снижению вирусной нагрузки при высоких дозах по данным ПЦР в реальном времени. Цитопатогенная доза превышает показатель 2 мг/мл. В дозировке 1 мг/мл снижение репликации вируса происходит в 5–13 раз. Сделаны выводы о перспективности данного направления и целесообразности использования ингаляционного пути введения препарата в организм.
антисмысловой олигонуклеотид
антисмысловая терапия
sars-cov-2
новая коронавирусная инфекция
covid-19
1. Орецкая Т.С., Метелев В.Г., Романова Е.А., Готтих М.Б. Синтетические нуклеиновые кислоты. Получение и перспективы терапевтического применения. М.: Цифровичок, 2015. 100 с.
2. Kim K.E., Salter D.W., Dodgson J.B. Examination of Antisense RNA and Oligodeoxynucleotides as Potential Inhibitors of Avian Leukosis Virus Replication in RP30 Cells. Poultry Science. 1998. vol. 77. no. 9. P. 1400-1410.
3. Barrey E., Burzio V., Dhorne-Pollet S., Eléouët J., Delmas B. Think Different with RNA Therapy: Can Antisense Oligonucleotides Be Used to Inhibit Replication and Transcription of SARS-Cov-2?. [Электронный ресурс]. URL: https://www.preprints.org/manuscript/202004.0412/v1 (дата обращения: 22.10.2020).
4. Lulla V. et al. Antisense oligonucleotides target a nearly invariant structural element from the SARS-CoV-2 genome and drive RNA degradation. [Электронный ресурс]. URL: https://www.biorxiv.org/content/10.1101/2020.09.18.304139v1 (дата обращения: 22.10.2020).
5. Стовба Л.Ф., Лебедев В.Н., Петров А.А., Ручко В.М., Кулиш В.С., Борисевич С.В. Новый коронавирус, вызывающий заболевания человека // Проблемы особо опасных инфекций. 2015. №. 2. С. 68-74.
6. Neuman B.W., Stein D.A., Kroeker A.D., Churchill M.J., Kim A.M., Kuhn P., Dawson P., Moulton H.M., Bestwick R.K., Iversen P.L., Buchmeier M.J. Inhibition, escape, and attenuated growth of severe acute respiratory syndrome coronavirus treated with antisense morpholino oligomers. Journal of Virology. 2005. no. 79. P. 9665-9676.
7. Neuman B.W., Stein D.A., Kroeker A.D., et al., Antisense Morpholino-Oligomers Directed against the 5` End of the Genome Inhibit Coronavirus Proliferation and Growth. Journal of virology. 2004. vol. 78. no. 11. P. 5891-5899.
8. Валентович Л., Латынский В. Олигокалькулятор. Биологический факультет БГУ. [Электронный ресурс]. URL: http://www.bio.bsu.by/molbiol/oligocalc.html (дата обращения: 22.10.2020).
9. Руководство по проведению доклинических исследований лекарственных средств. Часть 1/ Под ред. А.Н. Миронова. М.: Гриф и К, 2013. 944 с., стр. 527.
10. ПЦР в реальном времени / [Д.В. Ребриков и др.] / Под ред. Д. В. Ребрикова. 6-е изд. М.: Бином. Лаборатория знаний, 2015. 223 с.
11. Pharmacology of Antisense Drugs C. Frank Bennett, Brenda F. Baker, Nguyen Pham, Eric Swayze, and Richard S. Geary Annual Review of Pharmacology and Toxicology. 2017. vol. 57. no. 1. P. 81-105.
12. Colmenero I., Santonja C., Alonso-Riaño M., Noguera-Morel L., Hernández-Martín A., Andina D., Wiesner T., Rodríguez-Peralto J.L., Requena L., Torrelo A. SARS-CoV-2 endothelial infection causes COVID-19 chilblains: histopathological, immunohistochemical and ultrastructural study of seven paediatric cases. British journal of Dermatology. 2020. vol. 183. no. 4. P. 729-737.
13. Каюмова А.Ф., Габдулхакова И.Р., Шамратова А.Р., Инсарова Г.Е. Физиология системы дыхания: учебное пособие. Уфа: Изд-во ФГБОУ ВО БГМУ Минздрава России, 2016. 60 с.
14. Фролов Д.М., Алексеенко А.Ю., Новочадов В.В. Структурные изменения в легких при аэрозольном поступлении в организм липополисахарида, диспергированного в гидрофобной и водной фазе // Фундаментальные исследования. 2012. № 10-2. С. 345-348.

Пандемия коронавируса показала неготовность мирового сообщества к шестому технологическому укладу, основой которого являются нано- и биомедицинские технологии. Преодоление межвидового барьера и случайное проникновение дикого штамма коронавирусной инфекции SARS-CoV-2 летучих мышей в человеческую популяцию вызвали пандемию и тяжелейший экономический кризис из-за противоэпидемических мер. Разрушительный эффект в экономической, социальной и медицинской сферах в разных странах может послужить привлекательным примером для возможного использования такого биологического оружия в качестве инструмента ведения непрямых столкновений политических групп, террористических формирований и т.д.

Необходимость оперативного реагирования на такие масштабные угрозы при массовом поступлении зараженных и угроза еще большей контаминации населения вынуждают искать пути экстренного лечения потока больных и вирусоносителей. Причем это касается не только нынешней, но и будущих эпидемий, которые могут быть вызваны и другими респираторными вирусами – вирусом гриппа, респираторно-синтициальным вирусом, риновирусами, парамиксовирусами и т.д. Эта проблема противостояния новым инфекциям актуализируется в Указе Президента Российской Федерации от 12.10.2020 № 620 «О Межведомственной комиссии Совета Безопасности Российской Федерации по вопросам создания национальной системы защиты от новых инфекций».

Одним из возможных направлений в терапии вирусных инфекций, вызываемых РНК-вирусами, является терапия антисмысловыми олигонуклеотидами. Данные препараты действуют на уникальные участки генома вируса и являются перспективным направлением в генетических технологиях, важность которых подчеркивалась Президентом РФ В.В. Путиным на совещании от 14.05.2020 о развитии генетических технологий в РФ.

На сегодняшний день специфических противовирусных средств для огромного массива вирусов не существует. Однако разрабатываются методы специфического селективного «выключения» РНК, в том числе и вирусной, с помощью антисмысловых олигонуклеотидов. Принцип действия антисмысловых олигонуклеотидов заключается во введении в организм больного препарата, содержащего однонитиевые цепочки ДНК, комплементарные какому-либо участку однонитиевой ДНК или РНК, например РНК вируса. Комплементарное связывание ДНК препарата и РНК вируса приводит к невозможности транскрипции и трансляции вирусной РНК и вырезанию блокированного участка РНК вируса РНКазой Н. Это останавливает синтез новых вирусных частиц и предотвращает внутриклеточное размножение вируса [1].

Некоторые противовирусные антисмысловые препараты были выпущены на рынок, например фомивирсен (Vitraven) – препарат против цитомегаловируса (Novartis), Миравирсен – препарат для лечения гепатита С (Santaris Pharma). В настоящее время клинические испытания в различных фазах проходят более 100 препаратов от различных заболеваний, основанных на применении антисмысловых олигонуклеотидов.

Антисмысловая терапия представляет собой развивающуюся стратегию специфического лечения новых и социально значимых заболеваний. Принцип угнетения РНК ранее изучался in vitro для сдерживания репликации высокопатогенных РНК-вирусов [2]. Таким образом, учитывая предыдущий опыт терапии антисмысловыми олигонуклеотидами, можно предположить, что эта стратегия может быть применена в качестве антивирусного препарата путем связывания и расщепления РНК SARS-CoV-2. Учитывая, что SARS-CoV-2 является РНК-вирусом, который не интегрируется в геном хозяина, стратегия использования антисмысловых олигонуклеотидов, по мнению ряда авторов, может дать эффективные результаты [3, 4].

Предпосылки использования антисмысловой терапии при лечении Covid-19 существуют. Коронавирусные инфекции ранее уже вызывали вспышки эпидемий. В частности, вспышка атипичной пневмонии (тяжелого острого респираторного синдрома) в Китае в 2002–2003 гг. была вызвана коронавирусом SARS-CoV, вспышка ближневосточного респираторного синдрома (MERS) также была вызвана коронавирусом [5].

После эпидемии атипичной пневмонии многие авторы проводили исследования по влиянию антисмысловой терапии на подавление роста коронавирусов в исследуемых тканях [6, 7]. В этих работах авторы среди нескольких последовательностей нашли наиболее эффективные ингибиторы вирусной транскрипции, подавляющие размножение коронавируса в клетках и предотвращающие заражение других клеток. Это антисмысловые блокаторы, комплементарные начальным нуклеотидам вирусной РНК – так называемым регуляторным последовательностям транскрипции TRS (по терминологии авторов) штамма коронавируса SARS-CoV-Tor2 (GenBank AY274119). Нуклеотидная последовательность исследованных антисмысловых препаратов представлена в таблице 1.

Таблица 1

Исследованные антисмысловые препараты (1)

Наименование

Нуклеотидная последовательность (5`–3`)

№ блокируемых участков РНК вируса

TRS1

GTTCG TTTAG AGAAC AGATC

56–76

TRS2

TAAAG TTCGT TTAGA GAACAG

53–72

 

Указанные последовательности комплементарны следующим последовательностям нуклеиновой кислоты вируса (табл. 2).

Таблица 2

Генетические таргетные последовательности генома коронавирусов для препаратов TRS1 и TRS2

Наименование

Нуклеотидная последовательность вирусной РНК (5`–3`)

gen trs1

GATCTGTTCTCTAAACGAAC

gen trs2

CTGTTCTCTAAACGAACTTTA

* – стандартным является использование обозначения «Т» для урацила в РНК

Авторы использовали морфолиновую модификацию боковой цепи для предотвращения разрушения антисмыслового олигонуклеотида и конъюгацию с аргининовым полипептидом для улучшения проникновения в инфицированные клетки.

При сопоставлении данных нуклеотидных последовательностей (табл. 2) с последовательностью генома вируса SARS-CoV-2 (CoVid-19) было обнаружено наличие данных последовательностей почти во всех штаммах вируса, выделенных у пациентов во время пандемии 2019–2020 гг. (рисунок, нуклеотидные последовательности выделены красным цветом и рамкой).

BLAST-анализ показал 100%-ное совпадение последовательности РНК у всех подтипов коронавирусов, что предполагает высокую консервативность данного участка генома коронавирусов. Это позволяет использовать для лечения коронавирусной инфекции те антисмысловые олигонуклеотидные последовательности TRS1 и TRS2, которые были исследованы в 2005 г. коллективом [6].

Однако начиная с середины марта 2020 г. в штаммах вируса наблюдаются изменения, связанные с потерей участков с 5` конца. В частности, образец вируса MT263462 USA: WA 2020-03-23 не имел участков, обозначенных как trs1 и trs2. В связи с этим актуальным представляется исследование антисмыслового олигонуклеотида, комплементарного участку консервативной олигонуклеотидной последовательности генома вируса SARS-CoV-2, присутствующего во всех штаммах, что и было целью настоящего исследования.

В соответствии с целью исследования были поставлены следующие задачи: подобрать нуклеотидную последовательность вируса, которую предполагается ингибировать, осуществить синтез олигонуклеотида, определить цитотоксичность и противовирусную активность в эксперименте in vitro на культуре клеток.

Сравнительный анализ нуклеотидных последовательностей trs1 (выделен красным цветом) и trs2 (выделен рамкой) и выбранной новой последовательности (выделен зеленым) у возбудителя атипичной пневмонии 2002–2003 гг. (SARS-CoV-Tor2) и коронавирусной инфекции 2019–2020 гг. (SARS-CoV-2 (COVID-19))

Материал и методы исследования

1. Выбор нуклеотидной последовательности

Нуклеотидная последовательность, которую предполагалось блокировать у вируса SARS-CoV-2, была выбрана рядом с генами trs1 и trs2 на расстоянии четырех нуклеотидов от конечного участка (3`-конца) гена trs2. Такой выбор был обусловлен тем, что данная последовательность входит в участок сайта, регулирующего транскрипцию (transcription regulatory site, trs), и выключение данной последовательности также приведет к невозможности транскрипции по аналогии с ингибированием участков trs1 и trs2 в работе [6]. BLAST-анализ на ресурсе GenBank (NCBI) показал присутствие данной последовательности в геномах всех секвенированных образцов SARS-CoV-2. Данная последовательность имеет вид:

5`–CTG TGT GGC TGT CAC TCG GCT

В исследуемых нуклеотидных последовательностях коронавирусов на рисунке данная последовательность выделена зеленым цветом.

Комплементарная ей последовательность антисмыслового олигонуклеотидного препарата для лечения имеет вид:

5`–AGC CGA GTG ACA GCC ACA CAG

Выбор нуклеотидной последовательности вируса для блокирования антисмысловым препаратом также был продиктован минимальной способностью формировать нуклеотидные шпильки, препятствующие гибридизации участка РНК вируса и антисмыслового препарата. При расчете данной последовательности на олигокалькуляторе [8] было обнаружено, что на протяжении 210 нуклеотидов от 5`-конца последовательности вирусной РНК нуклеотиды могут теоретически формировать 38–39 шпилек, из которых исследуемая нами последовательность может быть задействована в 6 шпильках, в то время как последовательности trs1 и trs2 могут быть фрагментами 16 и 11 нуклеотидных шпилек соответственно. Таким образом, по теоретическим расчетам нами предполагался более специфичный характер выбранной нуклеотидной последовательности для блокирования транскрипции и трансляции вирусного генома, чем исследованные ранее в работе [6].

2. Синтез препарата

Синтез антисмыслового олигонуклеотида с фосфоротиоатной защитой боковой сахарофосфатной цепи 5`–AGCCGAGTGACAGCCACACAG был осуществлен по заказу компании «Genterra», Москва. Синтез (medium-scale DNA) осуществлен с фосфоротиоатной защитой фосфатной группы между всеми нуклеотидами c очисткой обращено-фазовой ВЭЖХ (Паспорт на синтетические олигонуклеотиды № 1312 от 14.04.2020). Общее количество синтезированного 21-членного олигонуклеотида составило 15,371 мг (2,38 мкмоль). Выбор фосфоротиоатной защиты олигонуклеотида для предотвращения нуклеазной деградации антисмыслового олигонуклеотида обусловлен низкой токсичностью фосфоротиоатных модификаций, коммерческой доступностью, возможностью синтеза больших количеств при рутинном автоматическом синтезе на ДНК-синтезаторах.

3. Исследование токсичности и противовирусной активности

Исследование токсичности и противовирусной активности было осуществлено по заказу в Испытательном центре контроля качества иммунобиологических лекарственных средств ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России (Исследование № 0044/20 от 11.09.2020).

Исследование включало в себя изучение цитотоксического действия антисмыслового препарата, изучение противовирусной активности препарата при лечебной схеме введения препарата, выявление РНК SARS-CoV-2 методом ПЦР в реальном режиме.

В экспериментальной работе использовалась перевиваемая линия клеток почки африканской зеленой мартышки (Chlorocebus aethiops) Vero-E6-, которая была предоставлена Всероссийской Коллекцией клеточных культур при ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России. Культивирование клеток осуществлялось на среде для выращивания клеток с добавлением фетальной бычьей сыворотки (FBS) (конечная концентрация – 10%).

В исследованиях использовался пандемический штамм коронавируса человека SARS-CoV-2 «ГК2020/1» пассаж 4, с инфекционной активностью 106 ТЦИД50/мл (тканевых цитопатогенных доз) для клеток Vero Е6 из Государственной Коллекции вирусов РФ при ФГБУ «НИЦЭМ им. Н.Ф. Гамалеи» Минздрава России.

Вирус культивировался в культуре клеток Vero Е6 в течение 96 ч при 37°С в 5%-ной атмосфере СО2. Инфекционная активность определялась согласно методам, рекомендованным ВОЗ.

Определение цитотоксического действия препарата в культуре клеток Vero Е6 проводилось с использованием 96-луночных культуральных плоскодонных планшетов, в которые помещали клетки Vero Е6 по 12 000 кл./лунку в объеме 100 мкл свежеприготовленной полной среды. Культивирование проводилось 24 ч при температуре 37°С в атмосфере 5% СО2. После инкубации клеток с препаратами в течение 96 ч при температуре 37°С в атмосфере 5% СО2 визуально оценивалось состояние клеточного монослоя. Далее культуральная среда из планшетов удалялась, и в каждую лунку к монослою культуры клеток добавлялось по 100 мкл среды для постановки реакции и 20 мкл раствора MTS. После инкубации в течение 3 ч при 37°С результаты учитывались на автоматическом ридере BIORAD при длине волны 490 нм. Референс-фильтр – 630 нм. Концентрация препаратов, уменьшающая значение оптической плотности при длине волны 490 нм на 50% по сравнению с контролем клеток, принималась за 50% цитотоксической дозы (СС50).

Эксперимент по оценке жизнеспособности клеток в тесте на противовирусную эффективность проводился в диапазоне концентраций препарата, не токсичных для клеток (т.е. ниже, чем обнаруженная величина СС50).

Противовирусная активность образца оценивалась визуально под микроскопом через 96 ч после инфицирования по ингибированию цитопатического действия вируса в культуре клеток Vero Е6. Результат оценивался по Δlgmax – максимальному снижению значения заражающей вирусной дозы в опыте по сравнению с контролем, выраженному в десятичных логарифмах. Изучение противовирусной активности субстанции антисмыслового олигонуклеотида в культуре клеток Vero Е6 осуществлялось с выбором концентраций на основании результатов исследования цитотоксичности. Рабочие растворы исследуемого препарата готовились с концентрациями 1,0 мг/мл; 0,1 мг/мл; 0,01 мг/мл и 0,001 мг/мл соответственно.

Клетки Vero Е6, используемые в исследовании, выращивались в 96-луночных культуральных планшетах в объеме 100 мкл полной в течение 24 ч при температуре 37°С в атмосфере 5% СО2. Посевная доза – 12 000 кл./лунку. По 100,0 мкл растворов тестируемого препарата переносились пипеткой из планшетов разведения тестируемого препарата в тест-планшеты с клетками. Каждая точка тестировалась в 4 параллельных лунках. В лунки контроля без вируса вносили соответствующие схеме разведения препараты (для оценки потенциального цитотоксического действия и дальнейшего учета результатов исследования). В лунки контроля клеток вносилась среда для постановки реакции.

Приготовление разведений вирусной суспензии для исследования противовирусной активности осуществлялось внесением в планшеты с монослоем культуры клеток Vero E6 суспензии SARS-CoV-2, пассаж 4, с инфекционной активностью 106 ТЦИД50/мл для клеток Vero E6 с изготовлением серии 10-кратных разведений: 101 – 106. Суспензия разводилась путем последовательного переноса в пробирках с нужным количеством реакционной среды – по 900 мкл реакционной среды и по 100 мкл вирусной суспензии.

Определение вирусной продукции по цитопатическому действию (ЦПД) проводилось на основе анализа жизнеспособности клеток при помощи микроскопирования, с целью визуального определения границы вирусного повреждения клеток, а также для осуществления контроля токсичности доз субстанций.

Оценка противовирусной активности препарата, помимо цитопатического действия, учитывалась и по снижению инфекционного титра вируса в культуре клеток Vero E6 по данным ПЦР РНК SARS-CoV-2, определяемых по порогу числа циклов реакции (cycle treshold, Ct) в различных разведениях исследуемого препарата.

Исследование РНК SARS-CoV-2 методом ПЦР проводилось путем забора 200 мкл надосадочной жидкости лунок с разведениями препарата, выделения РНК параллельно с положительным и отрицательным контролем. Результатом исследования являлось заключение о наличии/отсутствии РНК SARS-CoV-2 в культуральной жидкости при воздействии препарата: наличие РНК SARS-CoV-2 (значение Ct более 0), отсутствие РНК SARS-CoV-2 (значение Ct отсутствует).

Результаты исследования и их обсуждение

Оценка цитотоксичности препарата в различных концентрациях проводилась при инкубации препарата с клетками Vero Е6 в течение 96 ч с использованием красителя MTS и визуальной оценкой клеточного монослоя. На основании данных, полученных при изучении цитотоксического действия тестируемой субстанции с использованием MTS в культуре клеток Vero Е6, была построена аналитическая кривая, из которой была определена СС50.

Определение цитотоксичности субстанции антисмыслового олигонуклеотида при визуальной оценке состояния монослоя культуры клеток Vero Е6 под инвертированным микроскопом не выявило значительных изменений в морфологии клеток при концентрации вещества 2 мг/мл и ниже через 96 ч инкубирования препарата с клетками (табл. 3).

Таблица 3

Цитотоксичность антисмыслового препарата в культуре клеток Vero E6

Препарат

CC50 (мг/мл), 96 ч инкубации

Метод визуального определения

Метод с использованием MTS

Антисмысловой олигонуклеотид

>2

>2

 

Определение противовирусной эффективности антисмыслового олигонуклеотида по лечебной схеме (введение препарата через 24 ч после инфицирования) учитывали по снижению инфекционного титра вируса в культуре клеток Vero Е6 по цитопатическому действию. По итогам исследования было обнаружено, что препарат не ингибировал репликацию вируса SARS-CoV-2 в культуре клеток Vero Е6 в исследуемых концентрациях.

Результаты исследования противовирусной активности препарата методом ПЦР представлены в таблице 4. Из представленных данных видно, что статистически достоверных различий между показателем Ct группы контроля вируса и пороговым числом циклов в образцах с добавлением препарата нет. Единственным отличающимся значением обладает показатель Ct группы с добавлением препарата в дозировке 1,0 мг/мл, где значение Ct составляет 13,8 по сравнению с группой контроля вируса (11,4–10,1).

Таблица 4

Противовирусная активность препарата, определенная методом ПЦР в реальном времени РНК SARS-CoV-2 по пороговому числу циклов (Ct) при разведении вируса 10-4

Препарат

Концентрация препарата, мг/мл

Пороговое число циклов ПЦР (Ct)

Антисмысловой олигонуклеотид

1,0

13,8

0,1

11,2

0,01

11,2

0,001

10,3

Контроль вируса

11,4/10,1

Контроль клеток

отсутствует

 

В ходе исследований был установлено, что антисмысловой олигонуклеотид малотоксичен для культуры клеток Vero E6. Величина 50% цитотоксической дозы CC50 была выше 2,0 мг/мл (точные значения цитотоксической дозы не определены). При этом результаты визуального определения цитотоксичности препаратов (CC50) были сопоставимы с результатами определения СС50 с использованием витального красителя MTS. Таким образом, данный препарат является малотоксичным и безопасным для использования.

B результате исследования эффективности антисмыслового олигонуклеотида в опытах in vitro в отношении SARS-CoV-2 нe было обнаружено статистически достоверного противовирусного эффекта при лечебной схеме добавления препарата, потому что согласно [9] минимально эффективная вирус-ингибирующая концентрация – это концентрация препарата, снижающая титр вируса не менее чем на 1,5 1g.

При этом в результате исследования содержания РНК вируса при различных дозировках было обнаружено, что при дозировке препарата 0,001–0,1 мг/мл параметр Ct – количество циклов реакции амплификации (удвоения вирусной РНК), которое необходимо для достижения флуоресцентного сигнала, составляет 10,3–11,2 циклов удвоения. Контрольные значения Ct в опыте с инфицированными клетками без добавления антисмыслового олигонуклеотида составили 11,4–10,1. При дозировке же препарата 1 мг/мл величина Ct составила 13,8. Это означает, что при дозировке препарата в 1 мг/мл для достижения флуоресцентного сигнала, эквивалентного контрольной группе, потребовалось увеличить количество циклов амплификации в среднем на 2,4–3,7 цикла. Это свидетельствует о том, что дозировка препарата в 1 мг/мл не ингибировала полностью размножение вируса, но существенно снижала репликацию вирусной РНК. Снижение репликации вируса по расчету дополнительных циклов амплификации [10] составило диапазон в 5,3–13,0 раза (2 2,4 – 2 3,7). Следовательно, при дозировке 1 мг/мл препарата вирусная нагрузка клеток может быть снижена в 5,3–13 раз. Данное значение не может считаться статистически достоверным, однако налицо тенденция к снижению вирусной нагрузки, которая также может оказаться эффективной в противовирусной терапии.

Литературные данные и данные, полученные в эксперименте, свидетельствуют о том, что поиск противовирусных препаратов среди групп антисмысловых олигонуклеотидов против новой коронавирусной инфекции является перспективным направлением. Возможными путями усиления противовирусного эффекта могут быть использование конъюгатов олигонуклеотидов с другими лигандами или применение липосомальных форм введения препарата для улучшения проникновения препарата в клетки.

Для доклинических и клинических исследований противовирусной активности, а также для лечебно-профилактических мероприятий можно использовать фосфоротиоатную защиту как наиболее простую и дешевую в синтезе. Однако возможны и другие методы защищенных групп.

Учитывая, что вирус распространяется воздушно-пылевым и воздушно-капельным путем и поражает эпителий дыхательных путей и легких, перспективным и удобным методом введения могут быть ингаляции раствора препаратов через небулайзер. Ингаляции раствора препарата через небулайзер являются очень простыми, не требуют стерилизации, адресно достигают эпителия дыхательной системы, возможно их применение даже у очень тяжелых пациентов. При введении антисмысловых олигонуклеотидов ингаляционно проникновение в системный кровоток составляет менее 1% [11].

Предполагаемая дозировка для человека рассчитывается исходя из следующих соображений.

Вирус SARS-CoV-2 (COVID-19) – коронавирусная инфекция, которая поражает эпителий дыхательных путей и легких. Зараженной теоретически может оказаться любая клетка, в которой может произойти размножение до 100 тыс. вирусных частиц, каждая из которых может инфицировать другую клетку [12]. Общая площадь легких и дыхательных путей составляет в среднем 100 м2 (108 мм2) [13]. Поверхностная плотность альвеолоцитов на 1 мм2 составляет приблизительно 10 тыс. клеток (104) [14].

Таким образом, общее количество клеток легких и дыхательных путей составляет величину 1012 клеток. Если предположить, что все клетки являются инфицированными (по 100 000 вирусных частиц) и на каждую вирусную РНК необходима 1 молекула препарата, общее количество молекул препарата на одну дозу на 1 взрослого человека составит 1017, или 16 нмоль (102 мкг).

Обзор антисмысловых олигонуклеотидов показал, что токсичность данной группы препаратов представлена двумя видами. Первый их них – гибридизационно-зависимая токсичность – обусловлена специфичной последовательностью олигонуклеотида и возможным перекрестным связыванием с РНК, не являющейся мишенью лекарства, за счет полного или частичного совпадения последовательности нуклеотидов с мишенью, а также возможного аптамерного связывания с белками [11]. Преодоление этого вида токсичности возможно за счет надлежащего выбора РНК-мишени путем применения тщательного биоинформационного анализа для выявления мишени с идеальным структурным соответствием или малым числом несовпадающих оснований. Данный анализ выполняется на подготовительном этапе путем BLAST-анализа блокируемой последовательности с последовательностями других генов, опубликованных в GenBank (NCBI).

Второй вид токсичности – гибридизационно-независимая (неспецифическая) токсичность – обусловлена химическими свойствами олигонуклеотидов, взаимодействующих с белками, продуктами их распада. Данный вид токсичности зависит не от нуклеотидной последовательности, а только от химической модификации сахарофосфатного мостика.

Из данного положения следует вывод о том, что если правильно подобрана нуклеотидная последовательность антисмыслового препарата к нуклеотидной последовательности вируса (коронавируса, вируса гриппа и других РНК-вирусов), отсутствует возможное совпадение с другими генами (по данным BLAST-анализа), то токсичность и связанные с ней побочные эффекты/противопоказания будут зависеть только от химической модификации антисмыслового препарата и не будут зависеть от нуклеотидной последовательности и типа ингибируемого вируса.

Это дает широчайшие перспективы для создания противовирусных препаратов не только от коронавирусов, но и от других РНК-содержащих вирусов, например гриппа. При этом достаточно будет заранее определить неспецифическую токсичность олигонуклеотида с выбранной защитой сахарофосфатного остатка. При секвенировании генома нужного вируса можно будет использовать антисмысловые олигонуклеотиды в качестве лекарственных противовирусных средств с ускоренной проверкой токсичности в качестве своеобразных препаратов off-lable. Это в том числе даст возможность оперативного реагирования при возникновении угрозы следующей эпидемии в результате спонтанного проникновения вируса в человеческую популяцию.

Выводы

1. Исследование литературных данных показало перспективность применения антисмысловых олигонуклеотидов при лечении вирусных заболеваний, в частности вызываемых коронавирусами (например, SARS-CoV и MERS).

2. Олигонуклеотиды, ранее исследованные для атипичной пневмонии, комплементарны нуклеотидным последовательностям вирусной РНК новой коронавирусной инфекции почти во всех образцах и теоретически могут быть рассмотрены в качестве препаратов для лечения новой коронавирусной инфекции COVID-19.

3. Исследование антисмыслового олигонуклеотида с фосфоротиоатной защитой 5`–AGCCGAGTGACAGCCACACAG, комплементарного участку вирусной РНК вблизи 5`–конца, показало крайне низкую токсичность. Доза СС50 при исследованиях на культуре клеток Vero E6 составила более 2 мг/мл.

4. Исследование противовирусной активности антисмыслового олигонуклеотида на культуре клеток Vero E6 по данным ПЦР в реальном времени показало, что при дозировке 1 мг/мл снижение вирусной нагрузки составляет величину в 5,3–13 раз по сравнению с контрольной группой инфицированных клеток без лекарственного препарата.


Библиографическая ссылка

Горячев А.Н., Калантаров С.А., Ткачев В.В., Северова А.Г., Горячева А.С. ПОТЕНЦИАЛЬНАЯ ВОЗМОЖНОСТЬ АНТИСМЫСЛОВОЙ ТЕРАПИИ COVID-19 // Современные проблемы науки и образования. – 2020. – № 6.;
URL: http://www.science-education.ru/ru/article/view?id=30269 (дата обращения: 26.07.2021).

Предлагаем вашему вниманию журналы, издающиеся в издательстве «Академия Естествознания»
(Высокий импакт-фактор РИНЦ, тематика журналов охватывает все научные направления)

«Фундаментальные исследования» список ВАК ИФ РИНЦ = 1.074