Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

GENETIC ASPECTS OF THE FORMATION OF BRONCHOCONSTRICTION REACTIONS IN CHILDREN WITH BRONCHIAL ASTHMA UNDER CONDITIONS OF LOW TEMPERATURES IN YAKUTIA

Soloveva N.A. 1 Pavlova N.I. 1 Kurtanov K.A. 1 Varlamova M.A. 1 Dyakonova A.T. 1
1 Yakut science center of complex medical problems
В статье представлены результаты впервые проведенного исследования особенностей формирования холодовой гиперреактивности дыхательных путей (ХГДП) среди детского населения в условиях низких температур Республики Саха (Якутия) путем поиска ассоциации полиморфного варианта (rs1042713) A46G и полиморфного варианта (rs1042714) C79G гена β2-адренорецептора ADRB2 в группе больных бронхиальной астмой и здоровых индивидов, якутов по этнической принадлежности, проживающих на территории Республики Саха (Якутия). Всего проанализировано 326 образцов ДНК, выделенной из венозной крови, из них 103 образца ДНК принадлежат пациентам с бронхиальной астмой и 223 образца ДНК принадлежат индивидам, не имеющим в анамнезе патологии бронхолегочной системы. Обнаружена ассоциация аллеля А и генотипа АА полиморфного варианта (rs1042713) A46G, а также генотипа GG полиморфного варианта (rs1042714) C79G гена β2-адренорецептора ADRB2 с риском развития предрасположенности к бронхоконстрикторной реакции в ответ на вдыхание воздуха низкой температуры. Данные генетические маркеры могут быть использованы как факторы риска при прогнозировании формирования холодовой гиперреактивности дыхательных путей и развития побочных эффектов регулярной терапии β2-агонистами у детей якутов с бронхиальной астмой.
The article presents the results of the first study of the features of the formation of cold hyperreactivity of the respiratory tract (CHRT) among the child population at low temperatures of the Republic of Sakha (Yakutia) by searching for the Association of polymorphic variant (rs1042713) A46G and polymorphic variant (rs1042714) C79G gene β2-adrenergic receptor ADRB2 in the group of patients with asthma and healthy individuals, yakut by ethnicity living in the Republic of Sakha (Yakutia). A total of 326 DNA samples isolated from venous blood were analyzed, of which 103 DNA samples belong to patients with bronchial asthma and 223 DNA samples belong to individuals who do not have a history of pathology of the bronchopulmonary system. According to the results of the study, the association of allele A and genotype AA polymorphic variant (rs1042713) A46G, as well as the genotype GG polymorphic variant (rs1042714) c79g gene β2-adrenoreceptor ADRB2 with the risk of developing a predisposition to bronchoconstrictor reaction in response to inhalation of low temperature air. These genetic markers can be used as risk factors in predicting the formation of cold airway hyperreactivity and the development of side effects of regular therapy with β2-agonists in Yakut children with Bronchial asthma.
аsthma
cold airway hyperreactivity
genes
yakuts

Якутия является одним из самых крупных и контрастных по температурному режиму регионов мира, годовая амплитуда температурных показателей составляет порядка 102,8оC. Зимний период характеризуется колебанием температуры от –30ºС до –70ºС и длится порядка 7 месяцев в году. Таким образом, жители Якутии испытывают длительное воздействие экстремально низких температур, что негативно сказывается на состоянии их здоровья, способствуя развитию холодовой гиперреактивности дыхательных путей. У пациентов с бронхиальной астмой холодовая гиперреактивность дыхательных путей ухудшает течение заболевания, снижая качество жизни [1].

Согласно Федеральным клиническим рекомендациям по диагностике и лечению 2016 г. бронхиальная астма (БА) является гетерогенным заболеванием, характеризующимся хроническим воспалением дыхательных путей, наличием респираторных симптомов (свистящие хрипы, одышка, заложенность в груди и кашель), возникающих вследствие бронхиальной гиперреактивности, варьирующих по времени и интенсивности, проявляющихся вместе с вариабельной обструкцией дыхательных путей.

В основе бронхиальной гиперреактивности (БГР) при БА лежат повреждение эпителия дыхательных путей, увеличение его проницаемости для аллергенов, раздражение нервных окончаний различными медиаторами воспаления, что и приводит к развитию бронхоспазма.

В механизмах холодовой гиперреактивности дыхательных путей (ХГДП) существенная роль принадлежит неспецифической дегрануляции тучных клеток. Формирование ХГДП связано не только с альтерацией эпителия, но и с уровнем IgE в сыворотке крови. Отмечено, что, чем выше уровень IgE, тем выше уровень БГР, и наоборот. Важную роль в развитии бронхоспазма в ответ на вдыхание холодного воздуха играют лейкотриены. Это подтверждают исследования, в которых доказывается эффективность антагонистов лейкотриеновых рецепторов в предупреждении бронхоконстрикции при эукапнической гипервентиляции холодным воздухом [2].

Таким образом, ХГДП при БА – это результат комплексного воздействия персистирующего воспаления и структурных изменений бронхов, нарушения бронхомоторного тонуса, высокого уровня IgE, изменения функции гладкой мускулатуры бронхов и др.

Способствовать и предрасполагать к развитию ХГДП могут разные факторы: от негативного влияния окружающей среды (низкие температуры, ветер, пыль, смена метеоситуации) до наследственности и сопутствующих заболеваний [3, 4].

В качестве эндогенных (генетических) факторов, предрасполагающих к развитию ХГДП, может быть рассмотрен ген β2-адренорецептора (ADRB2), контролирующий процесс расслабления бронхов.

Согласно современным представлениям нарушение функции β2-адренорецепторов является важным механизмом бронхообструкции, а дефекты структуры или экспрессии белка β2-адренорецептора, как правило, приводят к изменению нормального контроля бронхиального тонуса, что сопровождается изменением ответа на бронхоконстрикторные воздействия [5].

Ген ADRB2 расположен на хромосоме 5q31, имеет 9 полиморфизмов в кодирующей части, некоторые из них ассоциированы с астматическими фенотипами. К ним относятся (rs1042713) A46G – замена нуклеотида аденина на гуанин, приводящая к замене аминокислоты аргинина на глицин в белке Argl6Gly и (rs1042714) C79G – замена нуклеотида цитозина на гуанин, приводящая к замене аминокислоты глутамина на глутаминовую кислоту Gln27Glu.

Результаты в отношении значимости данных полиморфизмов гена ADRB2 противоречивы: в ряде работ установлена значимость полиморфных локусов Arg16Gly и Gln27Glu в патогенезе БА, в формировании ответа пациентов на терапию β2-агонистами [6, 7, 8], в других источниках продемонстрирована их слабая ассоциация с БА [9, 10, 11]. Возможно, такая вариабельность результатов продиктована этническими особенностями исследованных популяций, факторами внешней среды, оказывающими влияние на клиническое течение заболевания, а также выбором препаратов и режимов их использования [12].

В связи с этим целью настоящего исследования явился поиск ассоциаций полиморфных вариантов р. (rs1042713) A46G и р. (rs1042714) C79G гена ADRB2 у детей якутов, больных атопической БА с холодовой гиперреактивностью дыхательных путей, в условиях низких температур Якутии.

Материалы и методы. Материалом исследования служили образцы ДНК больных атопической БА (n=103) в возрасте 6–15 лет (9,83±3,284) и образцы ДНК группы сравнения, состоявшей из 223 индивидов в возрасте от 9 до 18 лет (17,83±9,106), не имеющих БА и ХГДП в анамнезе. Группа больных БА и клинически здоровых лиц состояла из якутов, проживающих на территории Республики Саха (Якутия). Всем участникам исследования проведено комплексное клинико-функциональное обследование. Диагноз БА установлен на основании критериев, изложенных в национальных согласительных документах [1]. В каждом случае обследование включало двукратное проведение бронхопровокационной пробы с 3-минутной изокапнической гипервентиляцией холодным воздухом (ИГХВ) с интервалом 6 месяцев. Критерием фенотипа БА с ХГДП считалась дважды положительная реакция на бронхопровокационную пробу.

Для определения вклада гена ADRB2 в формирование ХГДП с учетом результатов пробы с ИГХВ из основной группы пациентов с БА (n=103) были сформированы две группы: группу 1 составили больные БА с положительной реакцией на ИГХВ (n=39), в группу 2 были включены пациенты с отрицательной реакцией на холодовую бронхопровокацию (n=64).

Молекулярно-генетическое исследование проводилось в лаборатории популяционной генетики и лаборатории наследственной патологии отдела молекулярной генетики ЯНЦ КМП. Анализ включал поиск ассоциаций полиморфных вариантов (rs1042713) A46G и (rs1042714) C79G гена ADRB2 с ХГДП.

Все образцы ДНК были выделены из цельной венозной крови методом фенол-хлороформной экстракции (коллекция биоматериала ЯНЦ КМП с использованием УНУ «Геном Якутии», рег. № USU_507512).

Генотипирование образцов ДНК осуществляли путем анализа продуктов ПЦР – амплификации специфических участков генома с последующим анализом полиморфизма длин рестрикционных фрагментов. Разделение продуктов ПЦР проводили при помощи электрофореза в 8%-ном полиакриламидном геле с последующей визуализацией с использованием видеосистемы (Vilber-Louren, Франция). Характеристика исследуемых полиморфизмов и условия ПЦР представлены в таблице 1.

Таблица 1

Характеристика полиморфных вариантов и условия ПЦР-ПДРФ анализа гена ADRB2

 

Полиморфизм

Последовательность праймеров

(5’→3’)

Метод

детекции

 

Номенклатура аллелей

(п.о.)

Ссылка

rs1042713

(c.46A>G)

p.Arg16Gly)

CCTTCTTGCTGGCACCCCAT

ПЦР/ПДРФ

(Nco I)

ADRB2*Arg (308)

ADRB2*Gly (292,16)

[13]

rs1042714

(c.79C>G)

p.Gln27Glu)

GGAAGTCCAAAACTCGCACCA

ПЦР/ПДРФ

(Bbv I)

ADRB2*Gln (259,49)

ADRB2*Glu (308)

 

Статистическую обработку данных проводили при помощи программы Statistica 13 for Windows. Распределение генотипов проверяли на соответствие равновесию Харди–Вайнберга с помощью точного теста Фишера. Для сравнения частот аллелей между различными группами использовали критерий χ2 с поправкой Йетса на непрерывность. Для оценки вероятности развития события использовали метод отношения шансов с применением программного продукта «Statcalc». Различия считали статистически значимыми при р<0,05.

Протокол исследования утвержден локальным комитетом по биомедицинской этике при ЯНЦ КМП.

Результаты и обсуждение

Распределение частот генотипов указанных полиморфных вариантов р. (rs1042713) A46G и р. (rs1042714) C79G гена ADRB2 соответствовало равновесию Харди–Вайнберга (p>0,05), данные представлены в таблице 2.

Таблица 2

Распределение частот генотипов и аллелей р. (rs1042713) A46G и р. (rs1042714) C79G гена ADRB2 в контрольной группе якутов

Полиморфизм

n

Генотип (%)

Частот аллеля

Х2

Ho

He

D

Arg16Gly (rs1042713)

223

AA

AG

GG

А

0,121

0,464

0,478

0,029

(16,4)

(46,7)

(36,9)

0,395

Gln27Glu (rs1042714)

223

CC

CG

GG

G

3,436

0,493

0,437

-0,128

(7,6)

(49,3)

(43,1)

0,677

Примечание: n – численность выборки, Ho, Heнаблюдаемая и ожидаемая гетерозиготность, D – относительное отклонение наблюдаемой гетерозиготности от ожидаемой.

Анализ распределения частот аллелей, полиморфных вариантов р. (rs1042713) A46G и р. (rs1042714) C79G гена ADRB2 у детей якутов, больных атопической БА, и практически здоровых индивидов не продемонстрировал значимых различий (табл. 3).

Таблица 3

Распределение полиморфных вариантов р. (rs1042713) A46G и р. (rs1042714) C79G гена ADRB2 среди якутов с БА и в контрольной группе

Номер

нуклеотида

Тип нуклеотида

 

Номер

замещаемой

аминокислоты

Генотипы

и аллели

 

БА

абс.(%)

(n=103)

Здоровые,

абс.(%)

(n=223)

Значимость, p

 

 

A46G

A

 

 

Argl6Gly

AA

12 (14)

32 (16,4)

 

*0,819

AG

43 (50)

91 (46,7)

G

 

GG

31 (36)

73 (36,9)

A

67 (38,95)

155 (39,54)

**0,970

G

105 (61,05)

237 (60,46)

 

C79G

C

 

 

Gln27Glu

CC

8 (7,8)

17 (7,6)

* 0,927

 

CG

53 (51,5)

110 (49,3)

G

 

GG

42 (40,7)

96 (43,1)

C

69 (33,5)

144 (32,3)

** 0,829

G

137 (66,5)

302 (67,7)

Примечание: достигнутый уровень значимости при сравнении распределения генотипов (*) и частоты аллелей (**) с показателями группы контроля, n – численность выборок.

Так, в контрольной группе без БА и группе с БА преобладал аллель G р. (rs1042713) A46G, его частота составила 60,46% и 61,05% соответственно. Для р.(rs1042714) C79G гена ADRB2 также наблюдалось преобладание аллеля G как в группе больных, так и в группе индивидов без БА, его частота составила 66,5% и 67,7% соответственно.

Распределение генотипов для исследуемых р. (rs1042713) A46G и р. (rs1042714) C79G гена ADRB2 характеризовалось преобладанием гетерозиготного генотипа AG р. (rs1042713) A46G и СG р. (rs1042713) A46G как в группе больных, так и в группе практически здоровых индивидов.

Анализ распределения генотипов и аллелей полиморфных вариантов гена ADRB2 в группах сравнения больных БА (группа 1 и группа 2), разделенных по характеру ответа на холодовую бронхопровокацию методом ИГХВ, продемонстрировал значимые различия как для р. (rs1042713) A46G, так и для р. (rs1042714) C79G (табл. 4).

Таблица 4

Распределение генотипов и аллелей полиморфных вариантов гена ADRB2 в группах сравнения больных БА, разделенных по характеру ответа на холодовую бронхопровокацию

Полиморфизм

Генотипы и аллели

Группа 1 (n=39), абс.(%)

Группа 2 (n=64), абс.(%)

Значимость, p

 

 

Arg16Gly

(rs1042713)

AA

13 (33,3)

9 (14)

 

*0,013

AG

19 (48,7)

28 (43,8)

GG

7 (18)

27 (42,2)

A

45 (57,7)

46 (36)

**0,004

G

26 (42,3)

112 (64)

 

Gln27Glu

(rs1042714)

СС

4 (10,3)

9 (14,1)

 

*0,04

СG

15 (38,5)

38 (59,4)

GG

20 (51,2)

17 (26,5)

С

23 (29,49)

56 (43,75)

**0,058

G

55 (70,51)

72 (56,25)

Примечание: достигнутый уровень значимости при сравнении распределения генотипов (*) и частоты аллелей (**) в группах сравнения 1 и 2, n – численность выборок.

Полиморфный вариант р. (rs1042713) A46G характеризовался преобладанием аллеля А (57,7%) и генотипа АА (33,3%) в группе 1 по сравнению с группой 2, в которой достоверно чаще встречались аллель G (64%) и гомозиготный генотип GG (42,2%). Отношение шансов по формированию ХГДП у носителей аллеля А составило 4,2 (2,24; 7,97), отношение шансов для генотипа АА составило 3,1 (1,05; 9,02), т.е. риск развития ХГДП для больных БА носителей аллеля А в 4,2 раза, а для носителей гомозиготного генотипа по данному аллелю в 3,1 раза больше, чем у больных носителей аллеля G и генотипов AG и GG.

Значимые отличия были получены для распределения генотипов р. (rs1042714) C79G. Достоверно чаще в группе пациентов с положительным ответом на холодовую бронхопровокацию встречался гомозиготный генотип GG (51,2%), тогда как в группе с отрицательным ответом преобладал гетерозиготный генотип СG (59,4%). Отношение шансов по формированию ХГДП у больных БА носителей генотипа GG составило 2,91 (1,16; 7,35).

Анализ распределения частот аллелей для исследуемого полиморфизма не выявил достоверных различий между группами – в обеих группах преобладал аллель G.

Выводы

По результатам проведенного в рамках НИР «Изучение генетической структуры и груза наследственной патологии популяций Республики Саха (Якутия)» ЯНЦ КМП исследования впервые установлено, что популяция якутов, проживающих в Республике Саха (Якутия), как больных БА, так и здоровых индивидов, характеризуется преобладанием аллелей G р. (rs1042713) A46G и р.(rs1042714) C79G гена ADRB2. Установлено, что носительство аллеля А и гомозиготного генотипа АА р. (rs1042713) A46G, а также носительство генотипа GG р. (rs1042714) C79G гена ADRB2 усугубляют течение БА у детей якутов за счет высокой предрасположенности к бронхоконстрикторной реакции в ответ на вдыхание воздуха в условиях низких температур. В свою очередь выраженная холодовая гиперреактивность дыхательных путей вынуждает пациентов практически регулярно использовать β2-агонисты в зимний период, что приводит к снижению контроля над заболеванием.

Таким образом, учитывая функциональную значимость и полученные результаты в отношении исследуемых полиморфизмов, а также климатические особенности Якутии (продолжительный период низких температур, неблагоприятно влияющих на состояние дыхательной системы), выявление аллеля А и генотипа АА р. (rs1042713) A46G, а также определение генотипа GG р. (rs1042714) C79G гена ADRB2 могут быть использованы как фактор риска при прогнозировании формирования холодовой гиперреактивности дыхательных путей и развития побочных эффектов регулярной терапии β2-агонистами у детей якутов с БА.