Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

ANALYSIS OF POLYMORPHISM OF THE GENES OF ACE 3 AND AMPD1 IN YOUNG SPORTSMEN OF THE KABARDINO-BALKARIA

Shomakhova A.M. 1 Sitnikov M.N. 1 Bogotova Z.I. 1 Bittueva M.M. 1 Khandokhov T.K. 1 Paritov A.Y. 1 Gidova E.M. 1
1 Kabardino-Balkarian state University H.M. Berbekova
Генетический паспорт спортсмена представляет собой индивидуальную базу данных ДНК. Его внедрение способствует новому научному подходу, начиная от выбора вида спорта и заканчивая режимом тренировок. В ходе исследования проведена работа по анализу I/D полиморфизма ACE гена (I-аллель гена является молекулярно-генетическим маркером выносливости, D-аллель гена – быстроты и силы) и гена AMPD1 (аллель С гена ассоциирован с выносливостью, Т-аллель гена – с быстротой и силой) у юных спортсменов, занимающихся контактными силовыми единоборствами. Все спортсмены, участвующие в эксперименте, имеют существенные спортивные достижения. Установлена частота аллелей генов, вносящих существенный вклад в детерминацию быстроты, силы и выносливости. С помощью аллель-специфичной ПЦР определена генотипическая структура выборки. Проведение молекулярно-генетических исследований полиморфизма генов помогает проводить отбор лиц, организм которых чувствителен к дополнительной физической деятельности, от тех, кому занятия спортом не рекомендованы или даже противопоказаны, при этом выявляется влияние тех или иных аллельных состояний генов на различные физические качества. Использование ДНК-диагностики в спорте откроет перспективы в поиске спортсменов с выдающимися наследственными качествами.
An athlete's genetic passport is an individual DNA database. Its introduction contributes to a new scientific approach, ranging from the choice of the sport to the training regime. During the study, I / D analysis of the ACE gene (I-allele of the gene is a molecular genetic marker of endurance, D-allele of the gene - speed and strength) and the AMPD1 gene (allele C of the gene associated with endurance, T-allele of the gene - with speed and strength) in young athletes involved in contact martial arts. All athletes participating in the experiment have significant sporting achievements. The frequency of alleles of genes that make a significant contribution to the determination of speed, strength and endurance is established. Using allele-specific PCR, the genotypic structure of the sample was determined. Conducting molecular genetic studies of gene polymorphism helps to select individuals whose body is sensitive to additional physical activity from those for whom exercise is not recommended or even contraindicated, and the contribution of various allelic states of the genes to various physical qualities is revealed. The use of DNA diagnostics in sports will open prospects in the search for athletes with outstanding hereditary qualities.
sports genetics
polymorphism
allele frequencies
dna diagnostics

Способность спортсменов показывать максимально возможный результат как следствие реализации заложенного природой потенциала спортсмена в профессиональном спорте постоянно позволяет находиться на переднем крае спортивных достижений. Новые технологии и методики обучения постоянно проверяются и разрабатываются для увеличения производительности и повышения уровня спортсменов до элитного уровня. При этом серьезные спортивные достижения являются результатом сложного взаимодействия целого ряда факторов: тренировок, питания, наследственной предрасположенности, условий внешней среды и т.п. По современным данным генетические факторы лежат в основе более 60% отличий спортсменов друг от друга. Такие характеристики спортсмена, как выносливость, сила, гибкость, мышечный размер и состав волокна, и другие признаки генетически детерминированы и являются важными компонентами спортивного успеха [1]. В связи с этим весьма актуальны исследования по выявлению влияния конкретных генетических комбинаций на спортивные достижения. Но ввиду полимерно-полигенной природы большинства наследственных признаков эти исследования являются весьма сложными и трудоемкими.

Современные достижения молекулярной генетики свидетельствуют о наличии в геноме человека более 12 миллионов ДНК-полиморфизмов, ассоциированных с индивидуальными особенностями и степенью проявления различных психофизиологических качеств индивидуума [1]. Взаимосвязь психических и физиологических особенностей личности и молекулярно-генетических механизмов, лежащих в основе проявления индивидуальных особенностей, привлекает внимание все большего числа специалистов спортивной физиологии, медицины и генетики.

Целью нашего исследования являлись выявление и анализ полиморфизма двух генов: ACE I (I-аллель гена ангиотензин-превращающего фермента; является маркером выносливости), ACE D (D-аллель гена ACE; маркер быстроты и силы) и AMPD1 С (С34-аллель гена АМФ-дезаминазы; маркер выносливости), AMPD1 Т (Т-аллель гена АМФ-дезаминазы; маркер быстроты и силы) у некоторых юных спортсменов, обучающихся контактным единоборствам в спортивных школах Кабардино-Балкарской республики.

В связи с поставленной целью нами решались следующие задачи:

1) сбор биологического материала и экстракция ДНК;

2) анализ частот аллелей и генотипов генов ACE3 и AMPD1 у юных спортсменов;

3) комплексная оценка вклада исследуемых генов в предрасположенность к занятиям различными видами спорта.

Для проведения настоящего исследования сбор образцов крови юных спортсменов КБР проводился по месту жительства исследуемых. В выборку входили 27 спортсменов, занимающихся карате и тхэквондо и имеющих достижения на уровне не ниже Северо-Кавказского федерального округа, средний возраст 13 лет. Данные о каждом участнике эксперимента собраны путем опроса и занесены в специально разработанную формализованную карту (ФК) – анкету. Анкета заполнялась индивидуально на каждого участника исследования.

Забор венозной крови проводился сертифицированной медицинской сестрой. Участие в исследовании было добровольным, обследуемые и их родители были полностью информированы обо всех аспектах своего участия в исследовании.

Методика исследования

Забор венозной крови

У обследуемых утром натощак проводили забор крови из вены. Забор клинического материала для исключения контаминации проводили с помощью стерильных одноразовых пробирок BD Vacutainer K2E 18.Omg объемом 10 мл, содержащих 0,5 мл 0,5М раствора ЭДТА (рН=8,0). Хранение проб проводилось при –20оС.

Молекулярно-генетические методы исследования

В работе использовали следующее оборудование: ламинарную систему (Россия), центрифуги (Германия), вортекс (Германия), термостаты, спектрофотометр, прибор для горизонтального электрофореза (США), источник питания (Россия), детектирующий амплификатор (Россия), УФ-трансиллюминатор со встроенной цифровой камерой̆ (Япония).

Для идентификации полиморфизма изучаемых генов-кандидатов была использована тотальная геномная ДНК. Анализ полиморфизма проводился методом полимеразной цепной реакции (ПЦР) с последующим электрофоретическим разделением продуктов амплификации.

Выделение ДНК осуществлялось из лимфоцитов периферической венозной крови с помощью реактивов из набора «АмплиСенс ДНК Сорб-С», Россия.

Для определения инсерционно-делеционного полиморфизма гена АСЕ проводилась стандартная ПЦР. Общий объем ПЦР смеси был 20 мкл. Для детекции полиморфизма генов использовали праймеры, фланкирующие полиморфный участок в 16-м интроне гена ACE [2].

АСЕ F — CTGGAGACCACTCCCATCCTTTCT — прямой праймер.

ACE R — GATGTGGCCATCACATCCGTCAGAT – обратный праймер.

Ожидаемые продукты амплификации 480 п.н. и 190 п.н.

Условия ПЦР:

денатурация 94оС – 7 мин   1 цикл

94оС — 1

60оС — 1             30 циклов

72оС — 1

Заключительный синтез: 72оС — 4 минуты

Продукты полимеразно-цепной реакции разделяли при помощи электрофореза в 1%-ном агарозном геле, затем гель окрашивали этидиум бромидом. Перед нанесением образец ДНК объемом 10 мкл смешивали с 2 мкл буфера для внесения, в состав которого входил 10%-ный бромфеноловый синий. На одну из дорожек геля наносили маркер молекулярного веса Lader 50 (Helicon) для определения размеров фрагментов ДНК, а также контрольные образцы, представленные мастер-миксом без ДНК. Электрофорез проводили при силе тока 50 mA в буфере TАEх1.

Статистическая обработка данных

Статистический анализ полученных результатов осуществляли с помощью пакета статистических программ Statistica for Windows v. 7.0 (StatSoft, Inc.). Частоты генотипов и аллелей рассчитывали по стандартным формулам [3].

Результаты и обсуждение

Выявление генов-кандидатов и последующий корреляционный анализ их полиморфизма с биохимическими и физиологическими особенностями базируются на предположении, что полиморфизм изучаемых генов связан с различным уровнем метаболических процессов в клетках и тканях [4].

Анализ частот генотипов по инсерционно-делеционному полиморфизму гена АСЕ показал, что с наибольшей частотой выявлен генотип ID, он составил 63,6%. Генотипы II и DD генотипированы с равной частотой – по 18,2%.

Анализ частот аллелей по I/D полиморфизму в исследуемой группе выявил равное соотношение аллелей I и D (по 50%). Полученные нами результаты согласуются с литературными данными о распределении частот аллелей и генотипов гена АСЕ в популяционных выборках.

В экспериментальной группе спортсменов анализ частот генотипов выявил гетерозиготный генотип ID с частотой 50,0%, II и DD генотипы 10,0% и 40,0% соответственно.

С наибольшей частотой в группе спортсменов встречается аллель D – 65,0%, с наименьшей аллель I – 35,0%. Проведенный анализ выявил статистически значимое преобладание генотипа DD и аллели D у экспериментальной группы спортсменов.

Особенностями ситуационных видов спорта, в частности спортивных единоборств, являются многообразие и интенсивность физических нагрузок. Характерным отличием контактных единоборств от других видов спорта является вариативность конфликтных ситуаций, в которых действует спортсмен, что требует непрерывного наблюдения за соперником и быстрого реагирования точными, своевременными действиями.

Высокие значения частоты делеционного аллеля гена АСЕ у спортсменов ассоциированы с более высоким уровнем локальной и общей физической работоспособности, а также они стимулируют развитие и проявление качеств силы и скорости, поскольку генотип DD детерминирует более высокое содержание быстрых волокон и относительно низкое содержание медленных волокон в скелетных мышцах по сравнению с представителями ID генотипа [5].Однако существует риск развития осложнений со стороны сердечно-сосудистой системы у спортсменов-единоборцев, поскольку отсутствие Alu-повторов 287 п.н. в интроне 16 ассоциируется с высокой активностью ангиотензин-превращающего фермента в тканях. Аллель D ассоциируют с риском развития ряда сердечно-сосудистых заболеваний: ИБС (ишемической болезни сердца), инфаркта миокарда (ИМ), артериальной гипертензии (АГ), гипертрофии миокарда левого желудочка и др. Возникающая гипертрофия левого желудочка – это результат адаптационной морфофункциональной перестройки сердца в ответ на регулярные интенсивные физические нагрузки, определяющей наиболее высокий уровень максимального систолического объема крови и физической работоспособности в условиях физической нагрузки субмаксимальной мощности. Гомозиготное состояние аллеля D гена АСЕ (генотип DD) может служить запускающим фактором роста кардиомиоцитов и стимулировать активность симпатического отдела вегетативной нервной системы при длительных физических перегрузках.

В исследованиях некоторых авторов отмечено, что генотип II характеризуется более высоким относительным содержанием медленных волокон и более низким содержанием быстрых волокон (50,1±13,9% и 16,2+6,6% соответственно) по сравнению с таковым при наличии генотипа DD (30,5±13,3% и 32,9±7,4%). К развитию скоростно-силовых физических качеств значительную генетическую предрасположенность имеют спортсмены, обладающие рецессивным генотипом DD. У индивидуумов, имеющих генотип II, отмечена предрасположенность к выполнению длительной физической работы. Такие данные подтверждают роль инсерционно-делеционного полиморфизма гена ACE в детерминации как локальной, так и общей физической работоспособности [6, 7]. Тем не менее анализ наших данных не дает достаточных оснований для столь однозначных выводов, поскольку в исследованной выборке спортсмены с разными генотипами имеют существенные спортивные достижения.

Ген AMPD1 локализуется в 1p13-21 и кодирует изоферменты, которые высоко экспрессируются в скелетных мышцах и регулируют в них энергетические процессы. Последовательность генов AMPD1 содержит 22 455 пар оснований, состоит из 16 экзонов и 15 интронов. Ген AMPD1 кодирует синтез аденозинмонофосфатдезаминазы (АМФ- дезаминаза), которая повышает эффективность синтеза АТФ в скелетной мускулатуре. При интенсивных физических нагрузках содержание АТФ падает, накапливается АМФ. Работа фермента АМФ-дезамины обеспечивает ресинтез АТФ при мышечном утомлении. А по данным исследователей, 95% AMPD-M сконцентрировано в быстрых мышечных волокнах II типа [8].

В таблице 1 представлено распределение генотипов гена AMPD1  в исследуемой выборке. Наблюдается преобладание доминантных гомозигот. Рецессивные гомозиготы представлены слабо, несколько больше гетерозигот. По результатам анализа частоты распределения C/T полиморфизма гена АMPD1 по генотипам составили: 76,9 % – CC, 15,4 % – CT, 7,7 % – TT.

Таблица 1

Распределение генотипов С/Т гена AMPD1 в исследуемой выборке.

Генотипы

Частота (%)

С/С

76,9

Т/Т

7,7

С/Т

15,4

 

В таблице 2 показаны частоты встречаемости аллелей гена AMPD1  в исследуемой выборке. Соотношение частот аллелей C и T соответствовало 84,6% и 15,4%. При этом аллель С является доминантным и представлен в основном в составе гомозиготных генотипов. Частота аллеля Т почти в 5 раз меньше встречаемости аллеля С.

Таблица 2

Частота встречаемости аллелей C/T гена AMPD1 в исследуемой выборке

Аллели

Частота (%)

С

84,6

Т

15,4

 

Недостаток фермента АМФ-дезаминазы связан с генетической мутацией, представляющей собой переход C> T в 34-м нуклеотиде, что в свою очередь приводит к формированию преждевременного стоп-кодона во втором экзоне и прекращению синтеза фермента.

Исследователи выявили, что у гомозиготных индивидуумов по аллелю С (генотип С/С) активность АМФ-дезаминазы составляет 1% от таковой у гомозигот Т/Т [9]. Для лиц с пониженной активностью фермента характерны быстрая утомляемость, слабость даже при незначительных физических нагрузках. При генотипе С/Т по гену AMPD1 в скелетных мышцах можно предполагать примерно равное распределение быстрых и медленных мышечных волокон. При генотипе С/С гена AMPD1 энергетические процессы в мышечных волокнах протекают в полной мере, ресинтеза АТФ при мышечном утомлении не происходит и «переключение» на альтернативные пути синтеза АТФ происходит только в случае значительных перегрузок.

В нашем исследовании наблюдалось превышение генотипа С/С над другими аллельными вариантами, что согласуется с литературными данными по распределению аллелей гена AMPD1 в разных популяциях и подтверждается достижениями юных спортсменов, участвовавших в нашем исследовании.

Результаты наших исследований обсуждались с участниками исследования и их тренерами для возможной последующей коррекции методики тренировок.

Заключение

Спортивная генетика – молодая наука, возникшая на стыке генетики, физиологии и медицины. Физическую активность, а также спортивные способности определяют по последним научным данным более 150 генов. Наряду с генетическими факторами немаловажное значение имеют и факторы, препятствующие занятиям профессиональным спортом.

На сегодняшний день в результате многочисленных экспериментов выявлено около 150 генов-кандидатов, определяющих физическую активность человека, а также различных факторов, осложняющих профессиональные занятия спортом. Например, идентифицированы гены, вносящие существенный вклад в контроль таких признаков, как сила, как физическая выносливость, скорость реакции.

Отбор спортсменов с наследственной предрасположенностью к занятиям тем или иным видом спорта на начальном этапе их профессиональной подготовки является одним из главных направлений современной спортивной генетики, при этом одновременно ставится задача минимизировать риск, обусловленный пиковыми нагрузками, для здоровья спортсмена. Комплексный медико-биологический контроль и анализ полиморфизма генов и их комбинаций помогают проводить отбор лиц, организм которых чувствителен к дополнительной физической деятельности, от тех, кому занятия спортом не рекомендованы или даже противопоказаны, при этом выявляется вклад тех или иных аллельных состояний генов на различные физические качества.

Использование ДНК-диагностики в спорте откроет перспективы в поиске спортсменов с выдающимися наследственными качествами с последующей разработкой индивидуального генетического паспорта спортсмена. Внедрение генетического паспорта спортсмена ляжет в основу новых научных подходов, начиная от выбора вида спорта и заканчивая режимом тренировок. Изменение программ обучения, физических упражнений или реабилитации на основе генетических характеристик может иметь существенное значение не только в области спорта, но и в области общественного здравоохранения после успешного проведения фундаментальных исследований.

Благодаря современным технологиям существует возможность исследовать генетический профиль спортсмена и определить, может ли конкретный генотип способствовать спортивной работе. Такие гены, как ACE, AMPD1и ACTN3, в работе ряда исследователей продемонстрировали высокую корреляцию для прогнозирования спортивного мастерства как в спорте с выносливостью, так и в силе, в то время как многие другие гены показали ассоциации с одним или другим. Однако следует подчеркнуть, что идентификация атлетического таланта вряд ли будет результатом небольшого числа генетических вариантов, скорее сложной комбинацией большого количества и структуры экспрессируемых генов, а также ряда условий окружающей среды.