Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

NOVEL MICRORNA SIGNATURE IN PREDICTION OF OVERALL SURVIVAL AND RISK OF RELAPSE IN PATIENTS WITH SERIOUS OVARIAN CANCER

Verenikina E.V. 1 Gvaldin D.Y. 1 Petrusenko N.A. 1 Kecheryukova M.M. 1
1 National Medical Research Centre for Oncology
Рак яичников как одно из самых распространенных гинекологических онкозаболеваний отличается высоким процентом летальных исходов. В последнее время наблюдается рост популярности микроРНК-тестов, основанных на измерении уровня экспрессии малых некодирующих РНК. Целью работы являлся поиск микроРНК-сигнатуры, с помощью которой можно с высокой степенью эффективности осуществлять прогнозирование и мониторинг серозного рака яичников. На основании данных the Cancer Genome Atlas (TCGA) были отобраны микроРНК, экспрессия которых ассоциирована с общей выживаемостью (ОВ) пациенток при раке яичников. В дальнейшем была набрана валидационная группа из 87 пациенток с верифицированным диагнозом «серозный рак яичников». На данном этапе методом RT-PCR валидировали результаты анализа TCGA и оценивали перспективы использования выбранных микроРНК в качестве прогностических маркеров. По результатам биоинформационного анализа выявлено 26 микроРНК, ассоциированных с ОВ. Методом логистической регрессии была определена микроРНК-сигнатура, для которой был рассчитан коэффициент risk score = (0.47 × RCQ hsa-miR-140-3p) + (-0.22 × RCQ hsa-miR-150-5p) + (0.26 × RCQ hsa-miR-221-3p). Качество теста, основанного на микроРНК сигнатуре, подтверждено с помощью валидационной когорты. Чувствительность теста для двухлетней выживаемости составила 92%, специфичность - 98%. Результаты нашего исследования имеют практическую значимость и могут быть применены для стратификации больных в зависимости от риска рецидивирования и прогрессирования опухоли.
Ovarian cancer, as one of the most common gynecological oncological diseases, is characterized by a high percentage of deaths. Recently, there has been an increase in the popularity of microRNA tests based on measuring the expression level of small noncoding RNAs. The purpose of this study was to search for a microRNA signature that can be used to predict and monitor serous ovarian cancer with a high degree of efficiency. Based on the Cancer Genome Atlas (TCGA) data, microRNAs were selected whose expression is associated with overall survival (OS) of patients with ovarian cancer. Subsequently, a validation group of 87 patients with a verified diagnosis of serous ovarian cancer was recruited. At this stage, the results of TCGA analysis were validated by RT-PCR and the prospects for using the selected microRNAs as prognostic markers were assessed. Bioinformatic analysis revealed 26 microRNAs associated with OS. The microRNA signature was determined by logistic regression, for which the risk score was calculated = (0.47 × RCQ hsa-miR-140-3p) + (-0.22 × RCQ hsa-miR-150-5p) + (0.26 × RCQ hsa- miR-221-3p). The quality of the test based on miRNA signature was confirmed using a validation cohort. The sensitivity of the test for a two-year survival rate was 92%, the specificity was 98%. The results of our study are of practical importance and can be applied to stratify patients according to the risk of relapse and tumor progression.
ovarian cancer
microrna
overall survival
the cancer genome atlas

Рак яичников занимает восьмое место по смертности среди женских онкозаболеваний. Так, за 2018 год в мировой практике зарегистрировано 295414 новых случаев и 184799 летальных исходов вследствие прогрессирования и последующего рецидивирования злокачественных опухолей яичников [1]. Одной из причин смертности является отсутствие эффективного и чувствительного метода выявления рака яичников на ранних стадиях, мониторинга течения заболевания, прогнозирования возможных рецидивов и прогрессирования опухоли [2; 3]. Современные методы диагностики и прогнозирования рецидивов серозного рака яичников, в том числе уровень CA125 в сыворотке крови, ультрасонография и трансвагинальное ультразвуковое исследование, все еще недостаточно эффективны на ранних стадиях заболевания [4], а во многих случаях не позволяют предсказать агрессивность протекания с последующим летальным исходом [5]. Дополнительные трудности связаны с молекулярно-генетической гетерогенностью злокачественных опухолей на поздних стадиях; в частности, онкогенез серозного рака яичников характеризуется изменением паттернов экспрессии генов и нестабильностью генома [6]. Для улучшения диагностики и мониторинга заболевания необходимо искать новые генетические маркеры, которые могут расширить понимание молекулярных механизмов развития опухоли яичников.

В последнее время стали популярными тесты, основанные на измерении экспрессии малых (длиной 19–22 нуклеотидов) некодирующих РНК, так называемые микроРНК-тесты. микроРНК регулируют экспрессию генов, специфически связываясь с участками генов-мишеней или мРНК [7; 8]. Скрининговые исследования, основанные на анализе микроРНК-транскриптома опухоли, продемонстрировали потенциал микроРНК в ранней диагностике рака яичников и в прогнозировании химиорезистентности опухолевых клеток [9; 10]. Наше исследование было направлено на идентификацию микроРНК-сигнатуры, которая позволит оценить прогноз и осуществлять мониторинг заболевания.

Материал и методы исследования

Дизайн исследования предполагал два этапа. На первом этапе оценивали дифференциальную экспрессию микроРНК по данным TCGA с последующим отбором пула микроРНК, ассоциированных с общей выживаемостью (ОВ). Второй этап предполагал исследование, в которое вошло 87 пациенток с верифицированным диагнозом «серозная карцинома яичников». Возраст больных находился в диапазоне от 24,6 до 76,3 года (53,3 ± 5,4 года). Диагноз в каждом случае был подтвержден гистологически в соответствии с классификацией FIGO (the International Federation of Gynecology and Obstetrics) 2014 года. На данном этапе проводили валидацию результатов анализа TCGA и оценивали перспективы использования выбранных микроРНК в качестве прогностических маркеров. Исследование получило одобрение от этического комитета ФГБУ «НМИЦ онкологии» Минздрава России, все пациентки предоставили добровольные письменные согласия на участие в исследовании.

Анализ данных the Cancer Genome Atlas (TCGA)

На основании данных открытой базы TCGA была сформирована основная группа с серозной цистаденокарциномой яичников (TCGA-OV), в которую были включены 563 опухолевых образца, подвергнутых микрочиповому анализу микроРНК. В качестве образцов сравнения для анализа дифференциально экспрессируемых (ДЭ) микроРНК использовали условно нормальные ткани яичников (n=8): TCGA-01-0631-11A-01T-0364-07, TCGA-01-0633-11A-01T-0364-07, TCGA-01-0637-11A-01T-0364-07, TCGA-01-0630-11A-01T-0364-07, TCGA-01-0628-11A-01T-0364-07, TCGA-01-0639-11A-01T-0364-07, TCGA-01-0636-11A-01T-0364-07, TCGA-01-0642-11A-02T-0364-07. Сбор и обработку данных проводили с помощью вычислительной программной среды R 4.0.2 (пакет TCGABiolinks) [11].

Выделение РНК

Не размораживая, фрагменты опухолевой ткани помещали в TRIzol (ThermoFisher, США) и гомогенизировали с помощью MagNALyser (Roshe, Швейцария). Экстракцию осуществляли согласно рекомендациям производителя TRIzol. Дополнительно очистку препаратов РНК проводили с помощью набора miRNAminiKit (Qiagen, Германия). Полученные образцы суммарной РНК обрабатывали препаратами ДНКазы 1 (ThermoFisher, США) для удаления геномной ДНК. Концентрацию нуклеиновых кислот оценивали на флуориметре Qubit (Thermo Fisher, США) согласно инструкции производителя. Синтез кДНК на РНК-матрице проводили с использованием набора MMLV Reverta («Синтол», Россия).

Анализ экспрессии микроРНК

Оценку относительной экспрессии (RCQ) микроРНК (hsa-miR-140-3p, hsa-miR-150-5p и hsa-miR-221-3p) проводили методом RT-PCR. В качестве референсных локусов использовали микроРНК miR-191-5p, miR-103a-1-5p и малую ядерную РНК RNU49. Стабильность экспрессии оценивали с помощью geNorm [12]. Дизайн специфичных олигонуклеотидных праймеров микроРНК (табл. 1) осуществляли с использованием соответственно Primer-BLAST [13], референсных последовательностей NCBI GenBank и базы данных miRBase [14] по описанному ранее протоколу [15]. ПЦР проводили на приборе Bio-Rad CFX96 (Bio-Rad, США). Анализ данных количественной ПЦР осуществляли методом 2-ΔΔ Сt [16].

Таблица 1

Последовательности праймеров, используемых в исследовании

МикроРНК

Прямой (F) и обратный (R) праймеры для амплификации 5’-3’

hsa-miR-150-5p

F: GCAGTCTCCCAACCCTTGTA

R: GTCCAGTTTTTTTTTTTTTTTCACTGG

hsa-miR-140-3p

F: CGCAGTACCACAGGGTAGA

R: CCAGTTTTTTTTTTTTTTTCCGTGGT

hsa-miR-221-3p

F: CGCAGAGCTACATTGTCTGC

R: TCCAGTTTTTTTTTTTTTTTGAAACCCA

RT-праймер

CAGGTCCAGTTTTTTTTTTTTTTTVN (где V — A, C и G; N - A, C, G и T)

Анализ выживаемости пациенток

С помощью метода Каплана – Мейера отбирали микроРНК, экспрессия которых оказывала значительное влияние на продолжительность ОВ. Экспрессию каждой микроРНК с учетом квантильных точек отсечения (верхняя – 0,7, нижняя – 0,3) подразделяли на низкую, умеренную и высокую. Затем анализировали группы с низкой и высокой экспрессией микроРНК. Отобранные на данном этапе микроРНК подвергали однофакторному и многофакторному анализу Кокса (пакет survutils). Исходя из данных многофакторного регрессионного анализа, рассчитывали risk score для найденной микроРНК-сигнатуры по формуле: risk score = β1 × RCQ miRNA1 + β2 × expression miRNA2+… βn × RCQ miRNAn, где β – коэффициенты многофакторного регрессионного анализа, соответствующие определенным микроРНК. Для оценки прогностических свойств микроРНК-сигнатуры применяли ассоциированный с временем анализ ROC кривых (пакет survivalROC) [17]. Критический уровень значимости при проверке статистических гипотез принимали равным 0.05.

Результаты исследования и их обсуждение

В ходе исследования было обнаружено 126 ДЭ микроРНК, из которых 61 микроРНК отличались сниженной экспрессией и 65 микроРНК – повышенной. Отобрано 33 микроРНК, уровень экспрессии которых был ассоциирован с ОВ пациенток. Среди них обнаружено 3 вирусных микроРНК: ebv-miR-BART19-3p, hiv1-miR-H1, hsv1-miR-H1-5p. По данным однофакторного регрессионного анализа, число микроРНК, опосредующих ОВ, сократилось до 26 (табл. 2). Часть выделенного пула микроРНК (HR<1) обладает протективным эффектом, т.е. повышение их экспрессии связано с увеличением выживаемости; 19 микроРНК (HR>1) реализуют опухолестимулирующий эффект, повышение их экспрессии сопряжено с прогрессированием опухоли и снижением выживаемости.

Таблица 2

Однофакторный и многофакторный анализ микроРНК, ассоциированных с выживаемостью

МикроРНК

Однофакторный анализ

Многофакторный анализ

HR (95% CI)

p-value

HR (95% CI)

p-value

ebv-miR-BART19-3p

1.1 (1-1.3)

0.0066

-

-

hiv1-miR-H1

1.2 (1.1-1.4)

0.0025

-

-

hsa-let-7b

1.2 (1-1.4)

0.017

-

-

hsa-miR-107

0.7 (0.57-0.85)

0.00031

-

-

hsa-miR-139-5p

1.5 (1-2.1)

0.041

-

-

hsa-miR-140-3p

1.3 (1.1-1.6)

0.003

1.6 (1.3-1.9)

<0.0001

hsa-miR-148a-3p

0.82 (0.73-0.92)

0.00061

-

-

hsa-miR-150-5p

0.9 (0.81-1)

0.047

0.8 (0.7-0.9)

0.00022

hsa-miR-15b-5p

0.82 (0.72-0.94)

0.0033

 

 

hsa-miR-188-5p

1.2 (1-1.3)

0.01

-

-

hsa-miR-202-3p

1.2 (1.1-1.4)

0.0034

-

-

hsa-miR-214-3p

1.2 (1-1.3)

0.008

-

-

hsa-miR-22-3p

1.2 (1-1.3)

0.0056

-

-

hsa-miR-221-3p

1.2 (1.1-1.4)

0.0027

1.3 (1.1-1.5)

0.001

hsa-miR-222-3p

1.2 (1.1-1.4)

0.0016

-

-

hsa-miR-27a-3p

1.2 (1-1.4)

0.026

-

-

hsa-miR-320a-3p

1.3 (1.1-1.5)

0.0023

-

-

hsa-miR-363-3p

0.91 (0.83-0.99)

0.021

-

-

hsa-miR-374a-5p

0.84 (0.74-0.96)

0.01

-

-

hsa-miR-379-5p

1.2 (1-1.4)

0.034

-

-

hsa-miR-494-3p

1.1 (1-1.2)

0.02

-

-

hsa-miR-572

1.2 (1.1-1.4)

0.0036

-

-

hsa-miR-638

1.2 (1-1.3)

0.0068

-

-

hsa-miR-660-5p

0.83 (0.71-0.97)

0.017

-

-

hsa-miR-665

1.6 (1.2-2.3)

0.0024

-

-

hsv1-miR-H1-5p

1.3 (1.1-1.5)

0.00034

-

-

Многофакторный регрессионный анализ позволил идентифицировать прогностическую сигнатуру, состоящую из трех микроРНК: risk score = (0.47 × RCQ hsa-miR-140-3p) + (-0.22 × RCQ hsa-miR-150-5p) + (0.26 × RCQ hsa-miR-221-3p). Показано, что увеличение risk score было связано со снижением ОВ (рис. 1).

Рис. 1. Кривые Каплана-Мейера, отражающие зависимость общей выживаемости от risk score микроРНК-сигнатуры по данным TCGA

Далее полученные результаты были валидированы на опухолевом материале пациенток с Юга России. Медиана risk score для валидационной выборки составила 13, HR - 1.5 (95% CI: 1.22-1.85), p<0.0001. Пациентки были разделены на две группы: группа низкого риска (risk score <13) и группа высокого риска (risk score ≥13). Установлено, что ОВ в группе низкого риска была существенно выше, на 43%, чем в группе высокого риска (p < 0.0001). Тест, основанный на микроРНК-сигнатуре, отличается высокими прогностическими качествами для 2-летней выживаемости: чувствительность и специфичность составили 92% и 98% соответственно (AUC = 0.981; рис. 2).

Рис. 2. ROC-анализ прогностических свойств микроРНК-сигнатуры как прогностического показателя для 2-летней выживаемости. AUC - площадь под кривой (area under curve)

В нашем исследовании были определен профиль экспрессии, содержащий 126 микроРНК, характерный для серозного рака яичников. По результатам однофакторного регрессионного анализа удалось выявить взаимосвязь 26 из 125 микроРНК с общей выживаемостью пациенток. Три из 25 микроРНК (hsa-miR-140-3p, hsa-miR-150-5p и hsa-miR-221-3p) вошли в прогностическую сигнатуру, определяющую прогноз течения онкозаболевания.

Нами сделано предположение, согласно которому hsa-miR-140-3p выполняет опухолестимулирующую роль, что выражается в снижении ОВ обратно пропорционально изменению экспрессии маркера (табл. 1). Подтверждением наших выводов служит экспериментальная работа Wang J. и сотрудников [18]. Авторы показали, что hsa-miR-140-3p способна напрямую связываться с MAPK1 и тем самым подавлять цитотоксическую активность NK клеток. В связи с этим возможен беспрепятственный рост опухолевых клеток яичников.

Напротив, hsa-miR-150-5p обладает онкосупрессорными свойствами. Нами установлена прямая зависимость между уровнем данной микроРНК и ОВ (табл. 2). В работе Xia B. и сотрудников показано, что длинная некодирующая РНК ZFAS1 способна подавлять экспрессию hsa-miR-150-5p в опухолевых клетках эпителиального рака яичников. Ось ZFAS1/miR-150-5p/Sp1 обеспечивает пролиферацию и миграцию опухолевых клеток, участвует в развитии химиорезистентности [19]. Позднее была показана связь другой длинной некодирующей РНК MIAT с уровнем hsa-miR-150-5p в клеточных линиях OVCAR3 и SKOV3. Сверхэкспрессия MIAT, сопровождающаяся снижением экспрессии hsa-miR-150-5p, ассоциирована с эпителиально-мезенхимальным переходом, посредством которого реализуется опухолевый рост, миграция и инвазия опухолевых клеток [20].

В настоящем исследовании продемонстрирован онкогенный эффект hsa-miR-221-3p при серозной карциноме яичников (табл. 1), и повышение ее уровня сопряжено со снижением ОВ. По литературным данным, hsa-miR-221-3p перспективна для ранней диагностики рака яичников. Так, тест, основанный на измерении экспрессии hsa-miR-200c-3p и hsa-miR-221-3p в плазме крови, отличается высокой диагностической точностью [21]. Hong F. и сотрудники доказали, что определение уровня hsa-miR-221-3p в сыворотке крови может быть использовано для уточнения стадии заболевания согласно классификации FIGO [22]. Авторы сообщили, что повышенная экспрессия данной микроРНК свидетельствует о неблагоприятном прогнозе [22]. К основным молекулярным механизмам hsa-miR-221-3p относится подавление р53-опосредованного апоптоза с последующей пролиферацией опухолевых клеток [23].

Заключение

Лечение пациенток с серозным раком яичников сопряжено со множеством проблем, начиная от поздней диагностики по причине отсутствия точных маркеров и заканчивая развитием устойчивости к химиотерапии. За последнее 20 лет был достигнут значительный прогресс в понимании вклада микроРНК в механизмы онкогенеза рака яичников. Достижения в данной области могут быть применены для улучшения методов диагностики и прогнозирования рака яичников. Нами была получена прогностическая микроРНК сигнатура, а также 26 микроРНК, ассоциированных с выживаемостью, которые могут быть использованы в мониторинге исследуемой онкопатологии и оценке прогноза заболевания. Результаты нашего исследования имеют практическую значимость и могут быть применены для стратификации больных в зависимости от риска рецидивирования и прогрессирования опухоли.