Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,931

MOLECULAR DETECTION OF HELICOBACTER GENUS BACTERIA IN GASTROINTESTINAL TRACT DISEASES

Isaeva G.Sh. 1 Shagimardanova E.I. 2 Shirshikova T.V. 2 Fazulzyanova A.I. 3 Rizvanov A.A. 2 Selkova E.P. 4
1 "Pharm-T"
2 Kazan Federal university
3 Kazan State Medical University
4 Moscow scientific researches epidemiology and microbiology
Цель исследования: обнаружение бактерий рода Helicobacter в желчи больных с различной патологией желудочно-кишечного тракта. Материалом для исследования служили образцы желчи от 33 пациентов. Детекцию хеликобактеров проводили с помощью полимеразной цепной реакций (ПЦР). ДНК бактерий рода Helicobacter была обнаружена в 12 случаях (36,4%). Положительные в отношении бактерий рода Helicobacter образцы ДНК были последовательно протестированы с помощью видоспецифических праймеров H. bilis, H. pullorum, H. pylori и H. rappini. В 7 случаях образцы были позитивными в отношении гена 23S рРНК H.pylori и столько же в отношении гена ureB H.rappini. Бактериальная микст-инфекция H.pylori +H.rappini обнаружена у 5 больных. Все образцы в отношении генов cdtB H.pullorum и cdtB H.bilis были негативными. Полученные результаты позволяют сделать первоначальные выводы о возможном участии бактерий рода Helicobacter в патогенезе заболеваний желудочно-кишечного тракта, но необходимы дальнейшие исследования.
Aim: the detection bacteria of Helicobacter genus in the bile of the patients with different gastrointestinal diseases. We examined the bile samples obtained from 33 patients (M-11, F-22, mean age - 43,6 ±0,9 ). The presence of Helicobacter species was tested by polymerase chain reactions (PCR). Gene 16S rDNA of Helicobacter genus was found in 12 cases (36,6%) of bile samples. Samples generating a positive result with the Helicobacter genus specific PCR were subsequently analyzed with species specific primers for detection of H. bilis, H. pullorum, H. pylori and H. rappini. 23S rRNA of H.pylori was found in 7 cases, the result for gene ureB of H.rappini was the same. Mix-infection H.pylori +H.rappini was found in 5 patients. All samples for genes cdtB of H.bilis and H.pullorum were negative. Conclusion. Due to the received data we can draw initial conclusion about the possible role of helicobacters in the pathogenesis of gastrointestinal tract’s diseases, but the further researches are necessary.
PCR
bile
enterohepatic helicobacters
Helicobacter pylori
В зависимости от занимаемой экологической ниши все бактерий рода Helicobacter условно разделяют на «желудочные» и «внежелудочные» или энтерогепатические. Последние, а их насчитывают более двадцати видов, составляют большую часть известных на сегодняшний день представителей этого рода. Эволюционно эти виды приобрели способность колонизировать кишечник и желчевыводящие пути животных, но некоторые из них обнаружены у человека. Данные последних исследований указывают на возможное участие хеликобактеров в патогенезе заболеваний гепатобилиарной системы [6; 13; 14]. Серологические исследования, проводимые различными исследователями, указывают на значительное превышение титров антител к поверхностным протеинам H.pylori, H.bilis, H.hepaticus, Н.pullorum в группе пациентов с хроническими заболеваниями гепатобилиарной системы по сравнению с группой здоровых доноров [1; 18; 19; 21]. С помощью молекулярно-генетических исследований в желчи больных с различными заболеваниями гепатобилиарной системы обнаруживают ДНК H.pylori и энтерогепатических хеликобактеров, на результаты этих исследований крайне противоречивы [12].

Целью данного исследования стало обнаружение бактерий рода Helicobacter в желчи больных с различной патологией желудочно-кишечного тракта.

Материал и методы исследования

Было обследовано 33 пациента, среди которых 11 мужчин и 22 женщины, обратившихся в лечебные учреждения г. Казани. Средний возраст составил 43,6±0,9 года. Среди обследованных пациентов у 21 больного была выявлена патология со стороны гепатобилиарной системы в виде хронического некалькулезного холецистита (ХНХ) (n=13), хронического вирусного гепатита С (n=7) и хронического гепатита невыясненной этиологии, ассоциированного с хроническим панкреатитом (n=1). Группу пациентов без патологии гепатобилиарной системы составили 12 больных с диагнозами хронический панкреатит (n=4), хронический гастродуоденит (n=4), спаечная болезнь с дискинезией толстого кишечника (n=2), гастроэзофагорефлюксная болезнь (n=1) и железодефицитная анемия (n=1). Материалом для исследования служили образцы желчи, взятые при дуоденальном зондировании (порции В и С). Для молекулярно-генетического исследования пробы желчи помещали в пробирки типа Эппендорф вместимостью 1,5 мл, маркировали и до транспортировки хранили при -20 °С не более одной недели. Выделение ДНК из биопроб (100 мкл желчи) производили сорбционным способом с использованием набора «Хеликопол» (НПФ «Литех», г. Москва) в соответствии с рекомендациями производителя. Для этого к 0,1 мл цельной желчи (каждую порцию анализируют отдельно) добавляли 0,9 мл физиологического раствора, центрифугировали при 13000 об/мин в течение 10 минут, затем удаляли супернатант и полученный осадок использовали для выделения ДНК. Далее осадок желчи помещали в 100 мкл лизирующего буфера, включающего 10 мкл Tris НL pH 8,8, 25 мМ ЭДТА, 100 мкг/мл протеиназы К, и инкубировали до полного растворения при 56 °С в течение 20 минут. К раствору добавляли 20 мкл водной суспензии сорбента и 500 мкл буфера, состоящего из 10 мМ Tris НL pH 8,0, 5,5 М гуанидинционата, 10 мМ ЭДТА. Суспензию инкубировали при комнатной температуре в течение 10 минут, периодически встряхивая, после чего осаждали сорбент центрифугированием на микроцентрифуге в течение 15 секунд при 13 тыс. об/мин. Супернатант удаляли с помощью вакуумного насоса, а сорбент дважды промывали 70%-ным этанолом и высушивали при 56 °С около 15 минут. Для элюции ДНК с сорбента в пробирки добавляли 50 мкл ТЕ-буфера, тщательно перемешивали на вортексе и инкубировали в течение 5 минут при 55 °С в термостате. Супернатант отделяли центрифугированием. Полученный раствор, снятый с сорбента, переносили в 0,5-мл пробирку и хранили при -20 °С.

Первый этап молекулярно-генетического исследования включал проведение универсальной ПЦР F2/R4 для амплификации фрагмента 16S рРНК размером 1456 п.о. с использованием праймеров, предложенных M. Rocha и соавт., F2-16S-CHPEC ATCCTGGCTCAGAGTGAACG и R4-16S-CHPEC CCTACGGTTACCTTGTTACGAC. Амплификацию проводили по следующей программе: 94 °С - 4 минуты; 94 °С - 30 сек, 60 °С - 30 сек, 72 °С - 80 сек в течение 40 циклов [20]. Реакцию ПЦР проводили в общем объеме 25 мкл в смеси, содержащей 1×реакционный буфер, 0,2 мМ смеси диоксинуклеозид трифосфатов, 2,5 мМ MgCl2, 0,5 ед. Taq полимеразы, по 0,5 мкМ каждого праймера и 10 нг ДНК в амплификаторе MJ Mini (BioRad).

Следующим этапом было проведение родоспецифичной ПЦР (C97/C98) с позитивными в реакции F2/R4 образцами ДНК для выявления фрагмента 16S рРНК бактерий рода Helicobacter размером 398 п.о. с использованием праймеров С97 GCTATGACGGGTATCC и С98 GATTTTACCCCTACACCA, предложенных Fox J.G. и соавт. [5]. Амплификацию осуществляли по следующей программе: 94 °С - 4 минуты; 94 °С - 30 сек, 54 °С - 90 сек, 72 °С - 60 сек в течение 35 циклов.

Образцы ДНК, имеющие положительный результат в специфичной ПЦР для рода Helicobacter, подвергли видоспецифической ПЦР с целью детекции четырех видов хеликобактеров H. bilis, H. pullorum, H. pylori и H. (Flexispira) rappini.

Детекция H.pylori. Определяемыми фрагментами ДНК являлись гомологичные участки гена 23S рРНК H.pylori размером 267 п.о. Видоспецифическую ПЦР проводили с применением праймеров HPY S AGGTTAAGAGGATGCGTCAGTC и HPY A CGCATGATATTCCCATTAGCAGT, предложенных A. Menard и соавт. [16]. Амплификацию осуществляли по следующей программе: 94 °С - 4 минуты; 94 °С - 60 сек, 55 °С - 60 сек, 72 °С - 60 сек в течение 40 циклов.

Детекция H. bilis. Определяемыми фрагментами ДНК являлись гомологичные участки гена cdtB H.bilis размером 151 п.о. Видоспецифичную ПЦР проводили с применением праймеров F2-cdtB-bilis CGAATCTATTATCCGGGCTTG и R2-cdtB-bilis GCCAAGCGAGTTCTATCATTAG, предложенных M. Rocha и соавт. по следующей программе: 94 °С - 4 минуты; 94 °С - 30 сек, 60 °С - 60 сек, 72 °С - 30 сек в течение 40 циклов [20].

Детекция H. pullorum. Определяемыми фрагментами ДНК являлись гомологичные участки гена cdtB H.pullorum размером 140 и 148 п.о. Видоспецифическую ПЦР проводили с применением праймеров F1-cdtB-pullorum GTCTTTTGAGTGGATTGGATTCT, F2-cdtB-pullorum GCCAGCAAGTCTTTTGAGTG и R2-cdtB-pullorum CACTCCGGGTGCTTGTGTAT, предложенных M. Rocha и соавт. по следующей программе: 94 °С - 4 минуты; 94 °С - 30 сек, 60 °С - 60 сек, 72 °С - 20 сек в течение 40 циклов [20].

Детекция H. rappini. Определяемыми фрагментами ДНК являлись гомологичные участки гена ureB H.rappini размером 101 п.о. Видоспецифическую ПЦР проводили с применением праймеров F1-ureB-rappini GATGATTAGGGCGACACAGC и R2-ureB-rappini CCCCAGATTCTATCTGCTTACTC, предложенных M. Rocha и соавт. по следующей программе: 94 °С - 4 минуты; 94 °С - 30 сек, 60 °С - 60 сек, 72 °С - 10 сек в течение 40 циклов [20].

Выявление амплифицированных фрагментов осуществляли путем их электрофоретического разделения в 2%-ном агарозном геле с добавлением бромистого этидия и флуоресцентной визуализацией в виде светящихся полос под действием ультрафиолетового света. Результаты документировали с помощью видеосистемы для регистрации гелей Gel Imager 2 (Helicon).

Результаты и их обсуждение

При ПЦР-исследовании образцов желчи, отобранных у 33 пациентов, универсальная F2/R4 реакция была положительной в 15 случаях. Последующая реакция С97/С98 выявила ДНК бактерий рода Helicobacter в 12 случаях (36,4%), из них в 2 образцах порции В и в 9 образцах порции С. В группе больных с патологией гепатобилиарной системы ДНК хеликобактеров обнаружена в 8 случаях, из них в 6 случаях хронического некалькулезного холецистита и в 2 случаях хронического гепатита, при этом в одном случае ассоциированного с вирусом гепатита С. Среди больных без патологии гепатобилиарной системы ДНК бактерий рода Helicobacter обнаружена у больных хроническим панкреатитом и дискинезией толстого кишечника. Достоверных различий по частоте обнаружения бактерий рода Helicobacter в обеих группах не выявлено.

Положительные в отношении бактерий рода Helicobacter образцы ДНК от 12 больных были последовательно протестированы с помощью видоспецифических праймеров H. bilis, H. pullorum, H. pylori и H. rappini. В 7 случаях образцы были позитивными в отношении гена 23S рРНК H.pylori и столько же в отношении гена ureB H.rappini. При этом H.pylori выявлен в желчи 4 больных гепатобилиарной патологией (у 3 больных хроническим холециститом, у одного больного хроническим гепатитом невыясненной этиологии), а H.rappini у 5 (у 3 больных хроническим холециститом, у 2 - хроническим гепатитом, в том числе в одном случае, ассоциированном с вирусом гепатита С). Бактериальная микст-инфекция H.pylori +H.rappini обнаружена у 5 больных. Все образцы в отношении генов cdtB H.pullorum и cdtB H.bilis были негативными.

Полученные данные указывают на наличие колонизации билиарного тракта бактериями рода Helicobacter больных с различными заболеваниями желудочно-кишечного тракта, причём в большинстве случаев с внежелудочными поражениями - желчного пузыря, печени, поджелудочной железы и кишечника. По данным различных исследователей, различные виды этого рода обнаруживают в желчи, желчном пузыре и печени больных с патологией гепатобилиарной системы, но наиболее часто встречаются H. pylori и энтерогепатические хеликобактеры H. bilis, H. pullorum, H. rappini. В нашем исследовании у 38,09% больных с гепатобилиарной патологией были изолированы хеликобактеры, по видовой принадлежности отнесенные к H.pylori и H. rappini, при этом в половине случаев в виде микст-инфекции.

H.rappini - мезофильная грамотрицательная извитая палочка, впервые описанная R. Rappin в 1881 году. В 1970 году V.G. Lockard и соавторы опубликовали электронную микрофотографию биоптата слизистой желудка собаки. На ней была видна извитая бактерия с 10-20 биполярно расположенными жгутиками и периплазматическими волокнами, полностью охватывающими тело клетки [15]. Позднее Bryner J.H. и др. выделили эти бактерии из абортусов собак и первоначально назвали Flexispira rappini [2]. После анализа нуклеотидной последовательности 16S рРНК их включили в состав рода Helicobacter. Кроме того, было установлено, что H.rappini достаточно гетерогенен и представляет собой группу, состоящую приблизительно из 10 генетических вариантов [4]. Сообщения о выделении этих бактерий от больных гастроэнтеритами собак и кошек указывают на зоонозную природу поражений, вызываемых H.rappini [11; 17]. У иммунодефицитных пациентов бактерии способны вызывать бактериемии [3; 9]. В нашем исследовании у 7 больных (21,2%) была изолирована ДНК H.rappini, при этом у 5 инфицированных выявлена патология со стороны гепатобилиарной системы больных, что может указывать на возможное участие этой бактерии в патогенезе заболеваний билиарного тракта. В проведенном исследовании в 5 случаях была выявлена смешанная инфекция H.pylori и H.rappini, в одном - вируса гепатита С и H.rappini. При смешанном инфицировании возможно синергетическое действие факторов патогенности микроорганизмов, что может способствовать усилению патогенетического воздействия на ЖКТ.

Однако если для энтерогепатических хеликобактеров желчный пузырь является привычной средой обитания, то для H.pylori желчь - агрессивная среда. Ингибирующее воздействие желчных кислот на H.pylori было продемонстрировано в работе M.L. Hanninen, где под действием хенодезоксихолевой и дезоксихолевой кислот (основных компонентов желчи) происходило разрушение этого микроорганизма in vitro [7]. Но бактериостатический эффект in vitro не может быть воспроизведен в той же степени in vivo. Исследования in vivo показывают обратную зависимость между концентрацией желчи и степенью обсемененности слизистой оболочки желудка H.pylori при гастродуоденальном рефлюксе [10]. Возможно, что H.pylori обладает адаптативными механизмами, которые защищают микроорганизм от агрессивного действия не только от кислотного окружения в желудке, но и от щелочной среды и желчных кислот в билиарном тракте. На это указывают результаты исследований о различной экспрессии вирулентных факторов при воздействии желчи на бактерии рода Helicobacter, которые могут способствовать сохранению их жизнеспособности в различных экологических нишах [8]. В проведенном исследовании ДНК H.pylori была обнаружена в желчи 21,2% больных с различной патологией ЖКТ, но преимущественно внежелудочной локализации (заболеваниями гепатобилиарной системы, поджелудочной железы и кишечника). Полученные нами результаты коррелируют с ранее проведенными исследованиями, и накопленные данные позволяют сделать первоначальные выводы о возможном участии H.pylori и энтерогепатических хеликобактеров в патогенезе заболеваний гепатобилиарной системы и кишечника. Но отсутствие достоверных статистических данных об инфицированности хеликобактерами в популяции здоровых людей без заболеваний желудочно-кишечного тракта заставляет с осторожностью относиться к полученным результатам. Отсутствие «золотого» стандарта диагностики бактерий рода Helicobacter в желчи также может оказывать сдерживающий эффект в исследованиях по изучению этиологической значимости этих бактерий в патогенезе заболеваний желудочно-кишечного тракта, преимущественно внежелудочной локализации. Несмотря на противоречивость мнений, это новое, быстро развивающееся направление молекулярной детекции бактерий рода Helicobacter можно отнести к весьма перспективному и требующему продолжения исследований в данной области.

Авторы выражают признательность за техническую поддержку данного исследования ООО «Ассоциация Медицины и Аналитики» (г. Санкт-Петербург, Россия) и за методическую помощь профессору Ф. Мегро, секретарю Европейской группы по изучению Helicobacters и Campylobacters (г. Бордо, Франция).

Рецензенты:

  1. Фролова О.А., д.м.н., профессор кафедры общей гигиены Казанской государственной медицинской академии, г. Казань.
  2. Багаева Т.В., д.б.н., профессор кафедры физиологии и биохимии растений Казанского (Приволжского) федерального университета, г. Казань.