Scientific journal
Modern problems of science and education
ISSN 2070-7428
"Перечень" ВАК
ИФ РИНЦ = 0,791

INFORMATIVE DNA MARKERS OF GENE RF1 – POLLEN FERTILITY RESTORER CMS PET1 IN SUNFLOWER

Markin N.V. 1 Usatenko T.V. 2 Usatov A.V. 1 Tikhobaeva V.E. 1 Gorbachenko O.F. 2 Kulishova G.A. 1 Azarin K.V. 1
1 Southern Federal University
2 Don Experimental Station L.A. Zhdanov VNIIMK
В работе на селекционном материале (17 материнских ЦМС-линий и 29 отцовских Rf-линий) Донской опытной станции им. Л.А. Жданова ВНИИМК изучены 9 ДНК-маркеров – ORS 511, ORS 224, ORS 317, ORS 630, ORS 799, ORS 1030, HRG01, HRG02 и STS-115, которые, по данным литературы, составляют общую с геном Rf1 – восстановителя фертильности пыльцы ЦМС PET1 группу сцепления. Из исследованных 9 маркеров отобраны три – HRG01, HRG02 и STS-115 для идентификации гена Rf1, высокая информативность которых была подтверждена полевыми испытаниями. На основе полученных результатов разработана мультиплексная ПЦР тест-система, эффективная для идентификации маркера ядерного гена Rf1 и митохондриального локуса orfH522 (ЦМС PET1), которая может быть использована в практике маркерной селекции подсолнечника.
On the breeding material – 17 CMS lines and 29 Rf-lines Don Experiment Station LA Zhdanov VNIIMK was study 9 DNA markers - ORS 511, ORS 224, ORS 317, ORS 630, ORS 799, ORS, 1030, HRG01, HRG02 and STS-115, which with the gene Rf1 – pollen fertility restorer CMS PET1 form a common linkage group. Three markers – HRG01, HRG02 and STS-115 were highly informative for identifying gene Rf1. Based on these results, it was to develop a multiplex PCR test-system for the detection of nuclear marker of gene Rf1 and mitochondrial locus orfH522 (CMS PET1). This test-system can be used in sunflower breeding.
sunflower (Helianthus annuus L.)
test-system
CMS
Rf genes
DNA markers

Введение

Подсолнечник - одна из основных масличных сельскохозяйственных культур, востребованных в народном хозяйстве. Одним из главных направлений селекции подсолнечника является получение гетерозисных гибридов. В коммерческом производстве доминируют гетерозисные гибриды, полученные на основе цитоплазматической мужской стерильности ЦМС РЕТ1. В восстановлении фертильности пыльцы ЦМС PET1 участвуют два доминантных ядерных гена. Один из них присутствует в генотипах большинства линий-закрепителей стерильности, а другой – Rf1 – должен быть введен в генотип гибридного потомства [5]. Поиск новых генотипов, несущих ген Rf1, актуально для получения родительских форм. В связи с этим остро стоит проблема быстрого и точного определения носителей генов Rf1 в генофонде этой культуры. В настоящее время процесс идентификации Rf1 – генотипов проводят классическим гибридологическим анализом, который длителен и трудоемок. Он включает проведение в поле скрещиваний и оценку фертильности пыльцы растений F1 на стадии цветения.

В связи с тем что данные о точной локализации гена Rf1 на генетической карте подсолнечника и его нуклеотидной последовательности в литературе не приведены, то одним из возможных способов его идентификации является использование ДНК-маркеров, ассоциированных с признаком восстановления фертильности пыльцы. Ранее для определения гена Rf1 подсолнечника у линий восстановителей фертильности пыльцы растений с различными типами ЦМС нами была исследована диагностическая ценность маркера HRG01 [2]. Также была изучена особенность амплификации и последовательность нуклеотидов этого маркера - HRG01 [3]. В настоящей работе мы расширили выборку тестируемых селекционных линий и увеличили количество ДНК-маркеров гена Rf1 c целью выбора наиболее информативных для их дальнейшего использования в гибридной селекции подсолнечника.

Материалы и методы исследований

Объектами исследования служили 17 ЦМС-линий и 29 Rf-линий подсолнечника селекции Донской опытной станции им. Л.А. Жданова ВНИИМК.

Поиск информативных ДНК-маркеров гена-восстановителя фертильности пыльцы (Rf1) проводили по 9 ДНК-мишеням, которые, исходя из данных литературы, на генетической карте подсолнечника находятся вблизи Rf1-гена (табл. 1).

Таблица 1

Маркеры, использованные для идентификации гена Rf1

Название маркера

Последовательность нуклеотидов праймеров

Источник

Размер фрагментов, п.н.

ORS 511

f- TGGCTCAGATTAAGTTCACACAG

r- CGGGTTGCGAGTAACAGGTA

[7]

155, 180

ORS 224

f- AACCAAAGCGCTGAAGAAATC

r- TGGACTAACTACCAGAAGCTAC

134, 110

ORS 317

f- TTTGGCAGTTTGGTGGCTTA

r- GGTCGTATGCTTAATTCTTTCTCT

160

ORS 630

f- GCACGACCCGGATATGTAAC

r- TGTGCTGAGGATGATATGCAG

346

ORS 799

f- ACTCCCTCCCATTCTCGTCT

r- TCCAGCAAGTCAGCAACAAC

142

ORS 1030

f- CCTTTGATGTAGTTAAGGAAGTTGTG

r- CGATCAATTTATATGACCGAATTACC

430

HRG01

f- TATGCATAATTAGTTATACCC

r- ACATAAGGATTATGTACGGG

[4]

 

454

HRG02

f- AAACGTGGGAGAGAGGTGG

r- AAACGTGGGCTGAAGAACTA

740

STS-115

f- CGAACTAATCATCATACAACCA

r- TCGGCTCTTATGTATGTTCAC

[8]

115, 370

Выделение геномной ДНК и ПЦР-анализ проводили согласно описанным методикам [1; 3]. Реакцию амплификации проводили в термоциклере Palm Cycler (Corbett Research, Австралия) по четырем программам: 1) один цикл: 10 мин. 94 °С; 35 циклов: 45 сек. 94 °С, 45 сек. 65 °С, 1 мин. 72 °С, один цикл: 6 мин. 72 °С (для HRG02), 2) один цикл: 5 мин. 95 °С; 35 циклов: 15 сек. 95 °С , 30 сек. 58 °С, 25 сек. 72 °С один цикл: 1 мин. 72 °С (для HRG01), 3). один цикл: 2 мин. 96 °С; 30 циклов: 30 сек. 94 °С , 40 сек. 55 °С, 1 мин. 72 °С, один цикл: 2 мин. 72 °С (для STS-115), 4) один цикл: 2 мин. 96 °С; 30 циклов: 30 сек. 94 °С , 40 сек. 58 °С, 1 мин. 72 °С, один цикл: 2 мин. 72 °С (для остальных маркеров).

Для разработки дизайна праймеров использовали программу PrimerQuestSM от Integrated DNA Technologies, Inc.

Результаты исследования и их обсуждение

В полевых условиях все отобранные 17 ЦМС-линий и 29 Rf-линий были исследованы на наличие/отсутствие гена Rf1. Было подтверждено, что все ЦМС-линии характеризуются мужски стерильной цитоплазмой и рецессивным гомозиготным (rf1rf1) состоянием гена-восстановителя фертильности пыльцы, а все Rf-линии по результатам тест-кроссов – стерильным цитоплазмоном и доминантным гомозиготным (Rf1Rf1) состоянием гена-восстановителя фертильности пыльцы.

Результаты ПЦР анализа продемонстрировали, что SSR-маркеры – ORS 317, ORS 630, ORS 799, ORS 1030 одинаково представлены как у линий-восстановителей фертильности пыльцы (Rf1Rf1), так и у ЦМС-линий (rf1rf1). Следовательно, данные SSR-маркеры не ассоциированы с признаком мужской фертильности, т.е. не информативны для идентификации гена Rf1 в генотипе подсолнечника.

В электрофоретических спектрах продуктов амплификации маркера – ORS 511 у ЦМС-линий ВД 1448,ЭД 169, ВД 344, ВД 151, ЭД 236, ВД 354, ВД 255, ВД 149 был визуализирован фрагмент размером около 180 п.н., который не встречается у других изученных линий. У ЦМС-линий: ВД 22, ЭД 869, ЭД 77, ЭД 95, ВД 350, ВД 356, ЭД 73; ЭД 931, J-10/544 и всех изученных линий-восстановителей детектирован фрагмент размером около 155 п.н. (рис. 1).

Примечание: 1-17 – ЦМС-линии (rf1rf1): 1- ВД 1448; 2 - ЭД 169; 3 - ВД 344; 4 - ВД 22; 5 - ЭД 869; 6 - ВД 151; 7 - ЭД 236; 8 - ЭД 77; 9 - ЭД 95; 10 - ВД 354; 11 - ВД 255; 12 - ВД 350; 13 - ВД 356; 14 - ВД 149; 15 - ЭД 73; 16 - ЭД 931; 17 – J-10/544; 18-47 - линии-восстановители фертильности пыльцы (Rf1Rf1): 18 – J-7/0306; 19 – J-8/361; 20 – J-8/7307; 21 – J-8/515; 22 – J-8/543; 23 – J-9/1228; 24 – J-9/1671; 25 - ВД 541; 27 - ВД 62; 28 - ВД 110; 29 – J-8/991; 30 - ЭД 788; 31 - ЭД 195; 32 - ЭД 114; 33 - ЭД 538; 34 – J-9/941152; 35 – J-8/0123; 36 – J-8/843; 37 – J-8/2288; 38 – J-7/40181; 39 – J-6/1854; 40 – J-7/90592; 41 – J-6/3867; 42 – J-6/70165; 43 – J-6/507; 44 – J-8/0211; 45 – J-7/698; 46 – J-9/4917; 47 – J-9/99017. 26 – отрицательный контроль. M – маркер молекулярной массы 1 Kb DNA Ladder (Fermentas), На рисунке отмечены фрагменты (около 180 п.н), амплифицированные у некоторых линий ЦМС.

Рисунок 1. Электрофоретические спектры продуктов амплификации маркера ORS 511

Другой электрофоретический спектр получен после амплификации маркера ORS 224. Так, у ЦМС-линий: ЭД 169, ВД 22, ЭД 869, ВД 151, ЭД 77, ЭД 95, ВД 354 амплифицирован фрагмент размером около 110 п.н., а у ЦМС-линий: ВД 1448, ВД 344, ЭД 236, ВД 255, ВД 350, ВД 356, ВД 149, ЭД 73, ЭД 931, J-10/544 и всех изученных Rf-линий – фрагмент размером около 134 п.н. Следовательно, маркеры ORS 511 и ORS 224 также не информативны для идентификации гена Rf1. Однако эти два маркера могут быть использованы для генотипирования и генетической паспортизации ЦМС-линий, так как демонстрируют полиморфный электрофоретический спектр продуктов их амплификации.

Высокоинформативными в идентификации Rf1-генотипов явились маркеры – HRG01, HRG02 и STS-115 (рис. 2).

Примечание: 1-17 – ЦМС-линии (rf1rf1); 18-46 - линии-восстановители фертильности пыльцы (Rf1Rf1) (названия линий приведены выше, рис. 1). 47 – отрицательный контроль. M – маркер молекулярной массы 1 Kb DNA Ladder (Fermentas). На рисунке выделены фрагменты, информативные для идентификации Rf- и ЦМС-линий.

Рисунок 2. Электрофоретические спектры продуктов амплификации маркеров: А – HRG01, Б – HRG02 и В – STS-115

В результате амплификации HRG01 и HRG02 у всех исследованных Rf-линий обнаружены фрагменты размером около 454 п.н. и 740 п.н. соответственно, тогда как у ЦМС-линий эти ПЦР-маркеры отсутствуют. Праймеры маркера STS-115 у всех изученных 36 линий подсолнечника инициировали синтез фрагмента размером около 115 п.н., и, кроме этого, у всех ЦМС-линий дополнительно визуализируется еще один фрагмент размером около 370 п.н.

Таким образом, результаты ПЦР-анализа свидетельствуют об идентификационной ценности маркеров HRG01, HRG02 и STS-115 для определения гена Rf1 в генотипе подсолнечника.

Одной из практических задач маркерной селекции является создание информативных и простых в использовании диагностических тест-систем. В связи с этим нами была разработана мультиплексная ПЦР тест-система, позволяющая в одной реакционной смеси идентифицировать наличие/отсутствие маркера гена-восстановителя фертильности пыльцы – Rf1, так и митохондриального локуса – orfH522. Так как известно, что митохондриальная ДНК стерильных растений с ЦМС PET1 отличается от митохондриальной ДНК фертильных форм наличием инверсии 11 т.н. и инсерции 5 т.н., приводящих к появлению новой открытой рамки считывания orfH522, которая транскрибируется вместе с геном atpA и кодирует белок 16 кДа [6].

Для разработки такой тест-системы была использована нуклеотидная последовательность маркера гена Rf1 – HRG01, определенная нами ранее [3], и последовательность нуклеотидов митохондриальной открытой рамки считывания – orfH522 (база данных NCBI GenBank, http://www.ncbi.nlm.nih.gov/nuccore/X55963.1).

На основании данных последовательностей нуклеотидов были созданы специфические праймеры для проведения мультиплексной ПЦР. Праймеры конструировали таким образом, чтобы амплификация маркеров системы ЦМС PET1-Rf1 осуществлялась с равной эффективностью. Испытания мультиплексной тест-системы показали, что она информативна для амплификации как маркера гена Rf1 – восстановителя фертильности, так и orfH522 ЦМС PET1.

Спектром практического применения разработанной мультиплексной ПЦР тест-системы может быть: а) идентификация генотипов на этапах получения родительских линий для гетерозисной селекции подсолнечника, б) оценка генетической чистоты линейного материала по признаку фертильности/стерильности пыльцы (уменьшение объема полевых работ), в) поиск новых доноров гена Rf1 восстановителя фертильности пыльцы ЦМС PET1 у сортов, а также диких видов.

Заключение

Таким образом, из 9 испытанных ДНК-маркеров – ORS 511, ORS 224, ORS 317, ORS 630, ORS 799, ORS 1030, HRG01, HRG02 и STS-115, которые, по данным литературы, составляют общую с геном Rf1 группу сцепления, отобраны три маркера - HRG01, HRG02 и STS-115 информативные для идентификации гена Rf1 – восстановителя фертильности пыльцы ЦМС PET1. Разработана мультиплексная ПЦР тест-система, эффективная для определения маркера ядерного гена Rf1 и митохондриального локуса orfH522 (ЦМС PET1), которая может быть использована в маркерной селекции подсолнечника.

Исследование выполнено в рамках темы Министерства образования и науки РФ (№ 4.5642.2011) и при финансовой поддержке ФЦП Министерства образования и науки РФ (госконтракт № 16.740.11.0485).

Рецензенты:

Михайлов Н.В., д-р с-х наук, заведующий лабораторией молекулярной диагностики и биотехнологии НИИ биоинформатики, биотехнологии и живых систем ДГАУ, п. Персиановский, Ростовская область.

Шкурат Т.П., д-р биол. наук, профессор, директор НИИ биологии ЮФУ, г. Ростов-на-Дону.